From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS01125 [old locus tag: NWMN_0201 ]
  • pan locus tag?: SAUPAN001152000
  • symbol: NWMN_RS01125
  • pan gene symbol?:
  • synonym:
  • product: SAM-dependent methyltransferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS01125 [old locus tag: NWMN_0201 ]
  • symbol: NWMN_RS01125
  • product: SAM-dependent methyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 258873..259634
  • length: 762
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_009641 (258873..259634) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTCTAAAGAAGCTGGTCATACATTTTTAGCTAAATTAGGAAAAACTCGTCTACGCCCC
    GGTGGTAAAGAAGCAACAGATTGGTTAATACAACAAGGGGCATTTTCACAAGATAAACAA
    GTGTTAGAAGTGGCATGTAATATGTGCACAACATCTATTTATCTAGCTCATACATATGGC
    TGTCACATTCAAGGCGTTGATATAAATAAGAAAGCATTAGAAAAAGCACAGGAAAACATT
    TCAGCAGCAGGTCTTGAATCATATATTCAAGTTCAACAAGCGAATGCTGTTAAATTGCCC
    TTTGATGACAATCAATTCGATATCGTTTTAAATGAAGCAATGTTAACAATGTTACCCATC
    GCCATAAAGGAAAAAGCATTACGCGAGTACTACCGAGTCTTAAAGCCTGGGGGTATCTTG
    TTAACACATGATATTGTCATCGTTAATGAATCACATGCCACACATGTTGTTAAATCATTA
    TCTGCAGCAATTAATGTCAATGTCTCACCGCAGACGAAACTTGGCTGGTTAGATTTATAT
    AATCAAGCTGGTTTTAATCATGTGCATTATCATACTGGTCCAATGAGTTTAATGACACCA
    AAAGGTTTAATTTATGACGAAGGTATTGTTGGAACTATAAAGATTATCAACAATGCTTTG
    AAAAAAGAAAATCGACCAATGTTTTGTAAAATGTTTAAAACGATGACTAAATTGCGTAAA
    GATATGAATTATATTACTTTTGTCGCTAAAAAAGAGCACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    762

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS01125 [old locus tag: NWMN_0201 ]
  • symbol: NWMN_RS01125
  • description: SAM-dependent methyltransferase
  • length: 253
  • theoretical pI: 9.42825
  • theoretical MW: 28346.8
  • GRAVY: -0.183399

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 58.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone demethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 48.9)
    and 14 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 3-demethylubiquinone-9 3-O-methyltransferase (TIGR01983; EC 2.1.1.64; HMM-score: 32.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 31.6)
    pseudaminic acid biosynthesis-associated methylase (TIGR03587; HMM-score: 23.9)
    Genetic information processing Protein fate Protein modification and repair methyltransferase, HemK family (TIGR00536; HMM-score: 23.6)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification protein-(glutamine-N5) methyltransferase, ribosomal protein L3-specific (TIGR03533; EC 2.1.1.-; HMM-score: 22.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Glutathione and analogs putative 4-mercaptohistidine N1-methyltranferase (TIGR04345; HMM-score: 21.9)
    Genetic information processing Protein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 21.6)
    methyltransferase, Rta_06860 family (TIGR04290; EC 2.1.1.-; HMM-score: 19)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 18.5)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein L11 methyltransferase (TIGR00406; EC 2.1.1.-; HMM-score: 18.3)
    Unknown function Enzymes of unknown specificity tRNA (cmo5U34)-methyltransferase (TIGR00740; EC 2.1.1.-; HMM-score: 16.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, beta subunit family (TIGR01373; HMM-score: 13.5)
    Metabolism Amino acid biosynthesis Other pyrrolysine biosynthesis protein PylD (TIGR03911; HMM-score: 13.4)
    Unknown function Enzymes of unknown specificity putative methylase (TIGR00537; HMM-score: 12.4)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 71.6)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 70.5)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 66.5)
    and 15 more
    Ubie_methyltran; ubiE/COQ5 methyltransferase family (PF01209; HMM-score: 55.2)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 40.8)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 39.1)
    CMAS; Mycolic acid cyclopropane synthetase (PF02353; HMM-score: 34.6)
    UPF0020; Putative RNA methylase family UPF0020 (PF01170; HMM-score: 30.1)
    Methyltransf_18; Methyltransferase domain (PF12847; HMM-score: 26.5)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 26.1)
    PrmA; Ribosomal protein L11 methyltransferase (PrmA) (PF06325; HMM-score: 23)
    CheR; CheR methyltransferase, SAM binding domain (PF01739; HMM-score: 19.5)
    Methyltransf_8; Hypothetical methyltransferase (PF05148; HMM-score: 18.4)
    Methyltransf_24; Methyltransferase domain (PF13578; HMM-score: 17.5)
    TrmK; tRNA (adenine(22)-N(1))-methyltransferase (PF04816; HMM-score: 15.4)
    TPMT; Thiopurine S-methyltransferase (TPMT) (PF05724; HMM-score: 13.5)
    ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 12.9)
    Methyltransf_10; Protein of unknown function (DUF890) (PF05971; HMM-score: 12.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.077335
    • TAT(Tat/SPI): 0.001947
    • LIPO(Sec/SPII): 0.0036
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 445953413 NCBI
  • RefSeq: WP_000031268 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MSKEAGHTFLAKLGKTRLRPGGKEATDWLIQQGAFSQDKQVLEVACNMCTTSIYLAHTYGCHIQGVDINKKALEKAQENISAAGLESYIQVQQANAVKLPFDDNQFDIVLNEAMLTMLPIAIKEKALREYYRVLKPGGILLTHDIVIVNESHATHVVKSLSAAINVNVSPQTKLGWLDLYNQAGFNHVHYHTGPMSLMTPKGLIYDEGIVGTIKIINNALKKENRPMFCKMFKTMTKLRKDMNYITFVAKKEH

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]