From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05285 [old locus tag: NWMN_0944 ]
  • pan locus tag?: SAUPAN003291000
  • symbol: NWMN_RS05285
  • pan gene symbol?: thiW
  • synonym:
  • product: ABC transporter ATP-binding protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS05285 [old locus tag: NWMN_0944 ]
  • symbol: NWMN_RS05285
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1048393..1049793
  • length: 1401
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_009641 (1048393..1049793) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_0944

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    GTGTTAAAAGTAAGTGATTTACGATTAAAATATCCAAGTGGTCAACGTAAAATTTTCGAT
    CATTTAAATATCACTATTCAAGACAAAGAAAAAGTACTTTTACTCGGTCCTTCTGGTTGC
    GGTAAAAGTACACTTCTGAATGTATTAAGTGGTATTGTTCCTAATTTAATTGAATTACCT
    ATGAAATATGATGAACTAATCGTTGACCCATTAAGTGGCGTTATTTTCCAAGACCCTGAT
    AGCCAGTTTTGTATGCCAAAAGTATACGAAGAACTTGCATTCGTTTTAGAAAATAGACAA
    TTACCACGTGAAGACATGGATGCGTTAATTATCAATGCTTTAAATATGGTCAATTTAAAT
    GTTACCCCTGAAACGTATATCAAAGATTTAAGTGGCGGGATGAAACAGAAATTGGCAATT
    GTTGAAACCATTCTTCAACAATCAAAAACATTGTTTTTAGATGAACCGACAGCAATGTTA
    GATGTTCAAGCAACAGAAGATTTATGGACTAAACTAATTGAACTTTGGGAAGATCAAACG
    GTTGTAATCGTTGAACATAAAGTTAAACACATCTGGAATCATGTCGACCGCGTCATTTTG
    ATGGATTATAACGGAAATATCATTGCCGATGAATGTCCTGAAATCATATTACAGAAGTAT
    GTTCATTTACTCAGTGAATATGGTGTGTGGCATCCACGTGCATGGGAATTCGCACCAAGT
    CGTGTTGACTTTCCAACAACAAACTCACACTTATTACAATTTAAAAATGGACGTATTATT
    CGCGGTAAATCAACATTGCTCTCATTCTCAGATTTAGAAATTGGTCTAGGTGAGTGGATT
    ACAATTACAGGGGCAAATGGTAGTGGTAAAACAACCTTGCTTGAATCAATTATGCAATTG
    ATTAAATATCAAGGTGATGTTTATTTTGAAAATCAGCGTTTAACAAAAATTAAACATGCA
    GCAAAACACATGTACCTAGTTTATCAAAACCCAGAATTACAATTTATAACAAATTCGGTT
    TATGATGAAATTAACATTCATTTTAATCACCTTTCTAAAGATCAAAGTGATGATGAAACG
    ATACAACTTTTAAAACTTTTAGATTTACAAAATGTAAAAGATCAACATCCTTATGAGTTG
    TCTATTGGTCAAAAACGACGCCTTAGCGTAGCTACCGCACTAAGTTCTAAAGCTGATATT
    ATCTTTTTAGATGAACCGACATTTGGACTTGATAGCCATAATACATTCCAGTTGATCAAA
    CTTTTCCAAAAGCGAATTAATTTGGGACAAAGTATTGTCATGGTTACACATGACGATGAA
    ATAATTGAACGTTATCCATCAAGAAGACTTAAAATTTCAGATGGTGCGTTACTAGATTGT
    GATGGTGATACGAATGTATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1401


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_RS05285 [old locus tag: NWMN_0944 ]
  • symbol: NWMN_RS05285
  • description: ABC transporter ATP-binding protein
  • length: 466
  • theoretical pI: 5.21638
  • theoretical MW: 53316
  • GRAVY: -0.181974

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 245.5)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 230)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.9)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 203.9)
    and 101 more
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 192.6)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 179.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 175.7)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 171.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 169.7)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 164.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 164.6)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.9)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 162.9)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 161.4)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 161.3)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 160.7)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 159.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 152.8)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 152.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.5)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 152.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 151.3)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 150.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 144.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 141)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 138.3)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 136.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 134.1)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 134.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 132.8)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 132)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 130.9)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 127.1)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 126.6)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 124.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 123.2)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 119.8)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 118.7)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 116.5)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 111.4)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.6)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 109.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 107.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104.3)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 104.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 103.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 103.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 99.3)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 98.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 97.9)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 96.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 92.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.7)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 92.3)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 91.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 87)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 85.1)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 77.9)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 76.3)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 75.4)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 66.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 64.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 60.1)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 53.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 52.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 52)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 52)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 30.1)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 24)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 23.3)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 22.8)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 21.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 20.1)
    Genetic information processing DNA metabolism Restriction/modification DNA sulfur modification protein DndD (TIGR03185; HMM-score: 19.9)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 19.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 19.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 18.3)
    rad50 (TIGR00606; HMM-score: 18.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 18.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 18)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 17.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 16.7)
    Cellular processes Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 16.6)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 15.9)
    Cell structure Cell envelope Surface structures twitching motility protein (TIGR01420; HMM-score: 15.3)
    Cellular processes Cellular processes Chemotaxis and motility twitching motility protein (TIGR01420; HMM-score: 15.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)
    Dot/Icm secretion system ATPase DotB (TIGR02524; HMM-score: 14.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 13.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 13.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 13.5)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 13.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 12.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 12.2)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 12)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 12)
    Cellular processes Cellular processes Pathogenesis type VI secretion protein IcmF (TIGR03348; HMM-score: 9.3)
  • TheSEED: see NWMN_0944
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 167.9)
    and 70 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 72.1)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 43.6)
    AAA_23; AAA domain (PF13476; HMM-score: 42)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 39.8)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 35.6)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 31.6)
    AAA_22; AAA domain (PF13401; HMM-score: 31.1)
    NACHT; NACHT domain (PF05729; HMM-score: 30.7)
    AAA_18; AAA domain (PF13238; HMM-score: 30.5)
    AAA_28; AAA domain (PF13521; HMM-score: 29.6)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 28.2)
    AAA_14; AAA domain (PF13173; HMM-score: 28.2)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 27.9)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 27.6)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 27.2)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 26.6)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 26.4)
    Rad17; Rad17 P-loop domain (PF03215; HMM-score: 26)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 25.9)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 25.3)
    AAA_19; AAA domain (PF13245; HMM-score: 25)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 24.5)
    NTPase_1; NTPase (PF03266; HMM-score: 22.6)
    AAA_24; AAA domain (PF13479; HMM-score: 22.3)
    AAA_30; AAA domain (PF13604; HMM-score: 22.2)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 22)
    nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 21.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.6)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 20.5)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 20.5)
    AAA_25; AAA domain (PF13481; HMM-score: 20.1)
    AAA_33; AAA domain (PF13671; HMM-score: 20)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 19.5)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 19.3)
    AAA_17; AAA domain (PF13207; HMM-score: 18.6)
    NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 18.6)
    KAP_NTPase; KAP family P-loop domain (PF07693; HMM-score: 18.2)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 17.9)
    Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 17.9)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 17.9)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 17.6)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 17.5)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 17.4)
    bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 17)
    PIF1; PIF1-like helicase (PF05970; HMM-score: 16.8)
    DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 16.6)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 16.5)
    AAA_13; AAA domain (PF13166; HMM-score: 16.5)
    ORC-CDC6-like; ORC-CDC6-like (PF24389; HMM-score: 16.5)
    dNK; Deoxynucleoside kinase (PF01712; HMM-score: 16.1)
    GvpD_P-loop; GvpD gas vesicle protein, P-loop domain (PF07088; HMM-score: 15.8)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 15.5)
    Septin; Septin (PF00735; HMM-score: 15.4)
    RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 15.4)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 15.3)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 15)
    DAP3; Mitochondrial ribosomal death-associated protein 3 (PF10236; HMM-score: 14.9)
    MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.1)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 13.8)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 13.6)
    Thymidylate_kin; Thymidylate kinase (PF02223; HMM-score: 13.4)
    VapE-like_dom; Virulence-associated protein E-like domain (PF05272; HMM-score: 13.4)
    AAA_27; AAA domain (PF13514; HMM-score: 13.3)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 13.2)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 13)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 12.4)
    MCM; MCM P-loop domain (PF00493; HMM-score: 12.2)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.2)
    Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 11)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.3288
    • Cytoplasmic Membrane Score: 0.6659
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0052
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.0045
    • TAT(Tat/SPI): 0.000346
    • LIPO(Sec/SPII): 0.008263
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MLKVSDLRLKYPSGQRKIFDHLNITIQDKEKVLLLGPSGCGKSTLLNVLSGIVPNLIELPMKYDELIVDPLSGVIFQDPDSQFCMPKVYEELAFVLENRQLPREDMDALIINALNMVNLNVTPETYIKDLSGGMKQKLAIVETILQQSKTLFLDEPTAMLDVQATEDLWTKLIELWEDQTVVIVEHKVKHIWNHVDRVILMDYNGNIIADECPEIILQKYVHLLSEYGVWHPRAWEFAPSRVDFPTTNSHLLQFKNGRIIRGKSTLLSFSDLEIGLGEWITITGANGSGKTTLLESIMQLIKYQGDVYFENQRLTKIKHAAKHMYLVYQNPELQFITNSVYDEINIHFNHLSKDQSDDETIQLLKLLDLQNVKDQHPYELSIGQKRRLSVATALSSKADIIFLDEPTFGLDSHNTFQLIKLFQKRINLGQSIVMVTHDDEIIERYPSRRLKISDGALLDCDGDTNV

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]