Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0477 [new locus tag: SA_RS02810 ]
- pan locus tag?: SAUPAN002283000
- symbol: SA0477
- pan gene symbol?: pdxS
- synonym:
- product: pyridoxal biosynthesis lyase PdxS
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0477 [new locus tag: SA_RS02810 ]
- symbol: SA0477
- product: pyridoxal biosynthesis lyase PdxS
- replicon: chromosome
- strand: +
- coordinates: 557598..558485
- length: 888
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123281 NCBI
- RefSeq: NP_373729 NCBI
- BioCyc: see SA_RS02810
- MicrobesOnline: 102755 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGAGTAAAATTATTGGATCAGACAGAGTCAAAAGAGGTATGGCTGAAATGCAAAAAGGC
GGCGTTATTATGGATGTCGTTAATGCTGAGCAAGCAAGAATTGCAGAAGAAGCAGGCGCG
GTAGCAGTTATGGCATTAGAACGAGTACCTTCTGATATTAGAGCTGCTGGTGGCGTTGCA
CGTATGGCAAACCCTAAAATTGTAGAAGAAGTAATGAATGCTGTTTCTATTCCAGTCATG
GCTAAAGCACGTATTGGTCATATCACTGAAGCAAGAGTATTAGAGGCGATGGGTGTTGAC
TATATTGATGAATCAGAAGTGTTAACACCAGCAGATGAGGAATATCACTTAAGAAAAGAT
CAATTTACAGTACCATTTGTATGTGGATGTCGTAATTTAGGTGAAGCTGCGCGTAGAATT
GGTGAAGGTGCTGCTATGTTACGTACTAAAGGTGAACCAGGTACAGGTAATATTGTTGAA
GCTGTAAGACATATGAGACAAGTTAATTCAGAAGTTAGTCGATTGACTGTAATGAATGAT
GATGAGATTATGACTTTTGCGAAAGATATCGGTGCGCCTTATGAAATTTTAAAACAAATT
AAAGACAATGGTCGTTTACCGGTAGTTAACTTTGCAGCTGGTGGCGTTGCGACTCCTCAA
GATGCTGCTTTAATGATGGAATTAGGTGCTGACGGTGTATTCGTTGGATCAGGTATTTTT
AAATCAGAAGATCCAGAAAAATTTGCTAAAGCAATTGTTCAAGCAACAACACATTACCAA
GACTATGAACTAATTGGAAGATTAGCAAGTGAACTTGGCACTGCTATGAAAGGTTTAGAT
ATCAATCAATTATCATTAGAAGAACGTATGCAAGAGCGTGGTTGGTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
888
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0477 [new locus tag: SA_RS02810 ]
- symbol: SA0477
- description: pyridoxal biosynthesis lyase PdxS
- length: 295
- theoretical pI: 4.83393
- theoretical MW: 31992.6
- GRAVY: -0.130847
⊟Function[edit | edit source]
- reaction: EC 4.3.3.6? ExPASyPyridoxal 5'-phosphate synthase (glutamine hydrolyzing) D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine = pyridoxal 5'-phosphate + L-glutamate + 3 H2O + phosphate
- TIGRFAM: Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal 5'-phosphate synthase, synthase subunit Pdx1 (TIGR00343; HMM-score: 505.6)and 15 moreUnknown function General putative TIM-barrel protein, nifR3 family (TIGR00737; HMM-score: 32.5)putative enoyl-[acyl-carrier-protein] reductase II (TIGR03151; EC 1.3.1.-; HMM-score: 23.2)glycosyl amidation-associated protein WbuZ (TIGR03572; HMM-score: 20.5)Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiamine-phosphate diphosphorylase (TIGR00693; EC 2.5.1.3; HMM-score: 19.7)Energy metabolism Glycolysis/gluconeogenesis triose-phosphate isomerase (TIGR00419; EC 5.3.1.1; HMM-score: 18.2)3-hexulose-6-phosphate synthase (TIGR03128; EC 4.1.2.43; HMM-score: 18)Amino acid biosynthesis Histidine family 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase (TIGR00007; EC 5.3.1.16; HMM-score: 17.1)Amino acid biosynthesis Aromatic amino acid family tryptophan synthase, alpha subunit (TIGR00262; EC 4.2.1.20; HMM-score: 16.7)Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis orotidine 5'-phosphate decarboxylase (TIGR01740; EC 4.1.1.23; HMM-score: 16.4)dihydroorotate dehydrogenase family protein (TIGR01037; EC 1.3.-.-; HMM-score: 15.8)Unknown function General hisA/hisF family protein (TIGR00734; HMM-score: 15.6)methylmalonyl-CoA mutase C-terminal domain (TIGR00640; HMM-score: 15.1)Amino acid biosynthesis Histidine family imidazoleglycerol phosphate synthase, cyclase subunit (TIGR00735; HMM-score: 15.1)geranylgeranylglyceryl phosphate synthase family protein (TIGR01768; EC 2.5.1.-; HMM-score: 13.4)Biosynthesis of cofactors, prosthetic groups, and carriers Other isopentenyl-diphosphate delta-isomerase, type 2 (TIGR02151; EC 5.3.3.2; HMM-score: 12.7)
- TheSEED :
- Pyridoxine biosynthesis glutamine amidotransferase, synthase subunit (EC 2.4.2.-)
- PFAM: TIM_barrel (CL0036) SOR_SNZ; SOR/SNZ family (PF01680; HMM-score: 356.9)and 14 moreThiG; Thiazole biosynthesis protein ThiG (PF05690; HMM-score: 47.9)Dus; Dihydrouridine synthase (Dus) (PF01207; HMM-score: 28.1)IGPS; Indole-3-glycerol phosphate synthase (PF00218; HMM-score: 23.8)His_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 23.7)NMO; Nitronate monooxygenase (PF03060; HMM-score: 22.6)OMPdecase; Orotidine 5'-phosphate decarboxylase / HUMPS family (PF00215; HMM-score: 20.9)NanE; Putative N-acetylmannosamine-6-phosphate epimerase (PF04131; HMM-score: 19.9)TMP-TENI; Thiamine monophosphate synthase (PF02581; HMM-score: 17.5)DUF561; Protein of unknown function (DUF561) (PF04481; HMM-score: 17.3)TetR_C (CL0174) TetR_C_27; Tetracyclin repressor-like, C-terminal domain (PF17935; HMM-score: 17)TIM_barrel (CL0036) FMN_dh; FMN-dependent dehydrogenase (PF01070; HMM-score: 15.6)IMPDH; IMP dehydrogenase / GMP reductase domain (PF00478; HMM-score: 14.7)Leu-IlvD (CL0364) Peptidase_S66C; LD-carboxypeptidase C-terminal domain (PF17676; HMM-score: 13.3)TIM_barrel (CL0036) TIM; Triosephosphate isomerase (PF00121; HMM-score: 13.2)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.6392
- Cytoplasmic Membrane Score: 0.3101
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0506
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004504
- TAT(Tat/SPI): 0.001201
- LIPO(Sec/SPII): 0.000466
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSKIIGSDRVKRGMAEMQKGGVIMDVVNAEQARIAEEAGAVAVMALERVPSDIRAAGGVARMANPKIVEEVMNAVSIPVMAKARIGHITEARVLEAMGVDYIDESEVLTPADEEYHLRKDQFTVPFVCGCRNLGEAARRIGEGAAMLRTKGEPGTGNIVEAVRHMRQVNSEVSRLTVMNDDEIMTFAKDIGAPYEILKQIKDNGRLPVVNFAAGGVATPQDAALMMELGADGVFVGSGIFKSEDPEKFAKAIVQATTHYQDYELIGRLASELGTAMKGLDINQLSLEERMQERGW
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA1984 (asp23) alkaline shock protein 23 [1] (data from MRSA252) SA1517 (citC) isocitrate dehydrogenase [1] (data from MRSA252) SA1409 (dnaK) molecular chaperone DnaK [1] (data from MRSA252) SA0731 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SA0505 (fus) elongation factor G [1] (data from MRSA252) SA1305 (hu) DNA-binding protein II [1] (data from MRSA252) SA2400 (mqo2) malate:quinone oxidoreductase [1] (data from MRSA252) SA1244 (odhB) dihydrolipoamide succinyltransferase [1] (data from MRSA252) SA0943-1 (pdhA) pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SA0944 (pdhB) pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) SA0945 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 subunit [1] (data from MRSA252) SA0946 (pdhD) dihydrolipoamide dehydrogenase [1] (data from MRSA252) SA0218 (pflB) formate acetyltransferase [1] (data from MRSA252) SA1520 (pykA) pyruvate kinase [1] (data from MRSA252) SA0496 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SA2044 (rplB) 50S ribosomal protein L2 [1] (data from MRSA252) SA2035 (rplE) 50S ribosomal protein L5 [1] (data from MRSA252) SA0497 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SA0498 (rplL) 50S ribosomal protein L7/L12 [1] (data from MRSA252) SA2029 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [1] (data from MRSA252) SA1502 (rplT) 50S ribosomal protein L20 [1] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SA2042 (rplV) 50S ribosomal protein L22 [1] (data from MRSA252) SA2045 (rplW) 50S ribosomal protein L23 [1] (data from MRSA252) SA1922 (rpmE2) 50S ribosomal protein L31 [1] (data from MRSA252) SA2023 (rpoA) DNA-directed RNA polymerase subunit alpha [1] (data from MRSA252) SA2041 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SA2024 (rpsK) 30S ribosomal protein S11 [1] (data from MRSA252) SA1245 (sucA) 2-oxoglutarate dehydrogenase E1 [1] (data from MRSA252) SA0506 (tuf) elongation factor Tu [1] (data from MRSA252) SA0829 hypothetical protein [1] (data from MRSA252) SA1532 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: PdxR* (activation) regulon
PdxR* (TF) important in Pyridoxine biosynthesis; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)