From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0547 [new locus tag: SA_RS03165 ]
  • pan locus tag?: SAUPAN002371000
  • symbol: mvaK1
  • pan gene symbol?: mvaK1
  • synonym:
  • product: mevalonate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0547 [new locus tag: SA_RS03165 ]
  • symbol: mvaK1
  • product: mevalonate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 640833..641672
  • length: 840
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATTGCAGTACCGTTTAACGCAGGTAAAATCAAAGTTTTAATAGAAGCCTTAGAGAGCGGG
    AACTATTCGTCTATTAAAAGCGATGTTTACGATGGTATGTTATATGATGCGCCTGACCAT
    CTTAAGTCTTTGGTGAACCGTTTTGTAGAATTAAATAATATTACAGAGCCGCTAGCAGTA
    ACGATCCAAACGAATTTACCACCATCACGTGGATTAGGATCGAGTGCAGCTGTCGCGGTT
    GCTTTTGTTCGTGCAAGTTATGATTTTTTAGGGAAATCATTAACGAAAGAAGAACTCATT
    GAAAAGGCTAATTGGGCAGAGCAAATTGCACATGGTAAACCAAGTGGTATTGATACGCAA
    ACGATTGTATCAGGCAAACCAGTTTGGTTCCAAAAAGGTCATGCTGAAACATTGAAAACG
    TTAAGTTTAGACGGCTATATGGTTGTTATTGATACTGGTGTGAAAGGTTCAACAAGACAA
    GCGGTAGAAGATGTTCATAAACTTTGTGAGGATCCTCAGTACATGTCACATGTAAAACAT
    ATCGGTAAGTTAGTTTTACGTGCGAGTGATGTGATTGAACATCATAACTTTGAAGCCCTA
    GCGGATATTTTTAATGAATGTCATGCGGATTTAAAGGCGTTGACAGTTAGTCATGATAAA
    ATAGAACAATTAATGAAAATTGGTAAAGAAAATGGTGCGATTGCTGGAAAACTTACTGGT
    GCTGGTCGTGGTGGAAGTATGTTATTGCTTGCCAAAGATTTACCAACAGCGAAAAATATT
    GTGAAAGCTGTAGAAAAAGCTGGTGCAGCACATACATGGATTGAGAATTTAGGAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0547 [new locus tag: SA_RS03165 ]
  • symbol: MvaK1
  • description: mevalonate kinase
  • length: 279
  • theoretical pI: 6.91869
  • theoretical MW: 30091.3
  • GRAVY: -0.102151

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Central intermediary metabolism Other mevalonate kinase (TIGR00549; EC 2.7.1.36; HMM-score: 245.8)
    and 6 more
    Metabolism Amino acid biosynthesis Aspartate family homoserine kinase (TIGR00191; EC 2.7.1.39; HMM-score: 47.2)
    Metabolism Energy metabolism Sugars galactokinase (TIGR00131; EC 2.7.1.6; HMM-score: 43.6)
    Metabolism Amino acid biosynthesis Aromatic amino acid family shikimate kinase (TIGR01920; EC 2.7.1.71; HMM-score: 36.6)
    Metabolism Central intermediary metabolism Other phosphomevalonate kinase (TIGR01220; EC 2.7.4.2; HMM-score: 25.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase (TIGR00154; EC 2.7.1.148; HMM-score: 20.7)
    Metabolism Central intermediary metabolism Other diphosphomevalonate decarboxylase (TIGR01240; EC 4.1.1.33; HMM-score: 14.6)
  • TheSEED:  
    Fatty Acids, Lipids, and Isoprenoids Isoprenoids Archaeal lipids  Mevalonate kinase (EC 2.7.1.36)
    and 2 more
    archaeal lipids bobik  Mevalonate kinase (EC 2.7.1.36)
    Isoprenoid Biosynthesis  Mevalonate kinase (EC 2.7.1.36)
  • PFAM:
    S5 (CL0329) GHMP_kinases_N; GHMP kinases N terminal domain (PF00288; HMM-score: 56.1)
    no clan defined GHMP_kinases_C; GHMP kinases C terminal (PF08544; HMM-score: 45.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006358
    • TAT(Tat/SPI): 0.000176
    • LIPO(Sec/SPII): 0.000633
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAVPFNAGKIKVLIEALESGNYSSIKSDVYDGMLYDAPDHLKSLVNRFVELNNITEPLAVTIQTNLPPSRGLGSSAAVAVAFVRASYDFLGKSLTKEELIEKANWAEQIAHGKPSGIDTQTIVSGKPVWFQKGHAETLKTLSLDGYMVVIDTGVKGSTRQAVEDVHKLCEDPQYMSHVKHIGKLVLRASDVIEHHNFEALADIFNECHADLKALTVSHDKIEQLMKIGKENGAIAGKLTGAGRGGSMLLLAKDLPTAKNIVKAVEKAGAAHTWIENLGG

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]