From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0670 [new locus tag: SA_RS03815 ]
  • pan locus tag?: SAUPAN002601000
  • symbol: SA0670
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0670 [new locus tag: SA_RS03815 ]
  • symbol: SA0670
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 763100..763708
  • length: 609
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGCAATTATTTGAAACAATGAAAATTGATAATGGACATATCCCTAGACTTACTTATCAT
    ACTAATCGCATAAAATGTTCTTCTGAGCGATTAAACTTTAAATTTGATGAACATGCATGG
    CGAAATGAATTAAACGATGTAACAACAAAGTATCACAGTGGTCAATATAGACTTAAAATC
    GTATTAAATGCTGAAAGCAAATTTGAAACGATAGTGTCACCTTTACCTGAGAAAAGTAGT
    TTTACAGCAAAATTTCAAGTGTTGCCCAAAGTAGTTAATCCAACTTTTATAAAAAATAAA
    ACGACAGAACGAAAGCATTTAGCACACAATCATGAAACAGATTTAATATTGCTAACTTCA
    GAGGACGGCAAGGTCCTTGAATTTGATATTGGCAACATTGTCATTGAAGAGGATGGAAAA
    TGGTACACACCAAGTTATAAAGATGATTTCTTAAAAGGATGCATGCGTGATTATTTAATA
    GATAGTGACAAACTTGTTGAAAAAGACTTTAATAAAAACGAATTGATTTATAAATATCAT
    AACAATGAGATACGTTTATTTTTGATAAATAGTTTACGAGAGGTTGCCGATGTCCACCTT
    TGCCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    609

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA0670 [new locus tag: SA_RS03815 ]
  • symbol: SA0670
  • description: hypothetical protein
  • length: 202
  • theoretical pI: 7.01683
  • theoretical MW: 23840
  • GRAVY: -0.569802

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Folic acid aminodeoxychorismate lyase (TIGR03461; EC 4.1.3.38; HMM-score: 49.7)
    and 1 more
    Metabolism Amino acid biosynthesis Pyruvate family branched-chain amino acid aminotransferase (TIGR01122; EC 2.6.1.42; HMM-score: 14.3)
  • TheSEED:  
    Amino Acids and Derivatives Aromatic amino acids and derivatives Tryptophan synthesis  Aminodeoxychorismate lyase (EC 4.1.3.38)
    and 5 more
    Clustering-based subsystems Fatty acid metabolic cluster COG1399  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Folate Tryp Chlamydiae  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Test - Folate  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Chorismate: Intermediate for synthesis of Tryptophan, PAPA antibiotics, PABA, 3-hydroxyanthranilate and more.  Aminodeoxychorismate lyase (EC 4.1.3.38)
  • PFAM:
    no clan defined Aminotran_4; Amino-transferase class IV (PF01063; HMM-score: 129.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00864
    • TAT(Tat/SPI): 0.00055
    • LIPO(Sec/SPII): 0.004618
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQLFETMKIDNGHIPRLTYHTNRIKCSSERLNFKFDEHAWRNELNDVTTKYHSGQYRLKIVLNAESKFETIVSPLPEKSSFTAKFQVLPKVVNPTFIKNKTTERKHLAHNHETDLILLTSEDGKVLEFDIGNIVIEEDGKWYTPSYKDDFLKGCMRDYLIDSDKLVEKDFNKNELIYKYHNNEIRLFLINSLREVADVHLCL

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]