From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00724
  • pan locus tag?: SAUPAN002601000
  • symbol: SAOUHSC_00724
  • pan gene symbol?:
  • synonym:
  • product: chorismate binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00724
  • symbol: SAOUHSC_00724
  • product: chorismate binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 707013..707621
  • length: 609
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGCAATTATTTGAAACAATGAAAATTGATAATGGACATATCCCTAGACTTACTTATCAT
    ACTAATCGCATAAAATGTTCTTCTGAGCGATTAAACTTTAAATTTGATGAACATGCATGG
    CGAAATGAATTAAACGATGTAACAACAAAGTATCACAGTGGTCAATATAGACTTAAAATC
    GTATTAAATGCTGAAAGCAAATTTGAAACGATAGTGTCACCTTTACCTGAGAAAAGTAGT
    TTTACAGCAAAATTTCAAGTGTTGCCCAAAGTAGTTAATCCAACTTTTATAAAAAATAAA
    ACGACAGAACGAAAGCATTTAGCACACAATCATGAAACAGATTTAATATTGCTAACTTCA
    GAGGACGGCAAGGTCCTTGAATTTGATATTGGCAACATTGTCATTGAAGAGGATGGAAAA
    TGGTACACACCAAGTTATAAAGATGATTTCTTAAAAGGATGCATGCGTGATTATTTAATA
    GATAGTGACAAACTTGTTGAAAAAGACTTTAATAAAAACGAATTGATTTATAAATATCAT
    AACAATGAGATACGTTTATTTTTGATAAATAGTTTACGAGAGGTTGCCGATGTCCACCTT
    TGCCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    609

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00724
  • symbol: SAOUHSC_00724
  • description: chorismate binding protein
  • length: 202
  • theoretical pI: 7.01683
  • theoretical MW: 23840
  • GRAVY: -0.569802

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Folic acid aminodeoxychorismate lyase (TIGR03461; EC 4.1.3.38; HMM-score: 49.7)
    and 1 more
    Metabolism Amino acid biosynthesis Pyruvate family branched-chain amino acid aminotransferase (TIGR01122; EC 2.6.1.42; HMM-score: 14.3)
  • TheSEED:  
    Amino Acids and Derivatives Aromatic amino acids and derivatives Tryptophan synthesis  Aminodeoxychorismate lyase (EC 4.1.3.38)
    and 5 more
    Clustering-based subsystems Fatty acid metabolic cluster COG1399  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Folate Tryp Chlamydiae  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Test - Folate  Aminodeoxychorismate lyase (EC 4.1.3.38)
    Chorismate: Intermediate for synthesis of Tryptophan, PAPA antibiotics, PABA, 3-hydroxyanthranilate and more.  Aminodeoxychorismate lyase (EC 4.1.3.38)
  • PFAM:
    no clan defined Aminotran_4; Amino-transferase class IV (PF01063; HMM-score: 129.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00864
    • TAT(Tat/SPI): 0.00055
    • LIPO(Sec/SPII): 0.004618
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MQLFETMKIDNGHIPRLTYHTNRIKCSSERLNFKFDEHAWRNELNDVTTKYHSGQYRLKIVLNAESKFETIVSPLPEKSSFTAKFQVLPKVVNPTFIKNKTTERKHLAHNHETDLILLTSEDGKVLEFDIGNIVIEEDGKWYTPSYKDDFLKGCMRDYLIDSDKLVEKDFNKNELIYKYHNNEIRLFLINSLREVADVHLCL

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]