From AureoWiki
Jump to: navigation, search

NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1363 [new locus tag: SA_RS07715 ]
  • pan locus tag?: SAUPAN004110000
  • symbol: SA1363
  • pan gene symbol?: lipM
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1363 [new locus tag: SA_RS07715 ]
  • symbol: SA1363
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1571130..1571960
  • length: 831
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGACTGAAACTTGGAATTTTATTAATACAGGAAGTAAAGACCCATATTATAATATGGCA
    ATGGATGAAGCGTTATTAAATTTTGTCTCTAGAGGTGAAATTGATCCAGTTATACGTTTT
    TACACATGGAATCCTGCAACATTATCAATAGGGTATTTCCAAAGGCTACAAAAAGAAATT
    GATATTGATAAGGTTAAAGAGAAAGGTTTTGGTCTCGTAAGGCGTCAAACTGGTGGCCGT
    GGGGTGCTACATGATAAAGAGTTAACTTACAGTGTGATTGTGCCTGAATCGCATCCGAAT
    ATGCCTTCTACAGTTACAGAAGCGTACAGAGTGATTTCACAAGGATTATTAGAAGGATTT
    AAAAACTTAGGATTTGATACTTATTTTGCGGTACCTAAAACGCCTGAAGAGCGTCAAAAA
    TTAAAACAACCTCGAAGTTCAGTGTGTTTTGATGCACCAAGTTGGTATGAGCTAGTTGTT
    GAAGGCCGTAAGATTGCTGGGAGTGCTCAAACGAGACAAAAGGGCGTAATCCTCCAACAC
    GGTTCGATTTTACAAGATATTGATATTGATGAACTGTTTGATATGTTTATTTATAAAAAT
    GAAAGATTAAAATTAAAAATGAAAGAGGCATTCGTTGAAAAAGCAGTTGCCATCAATGAT
    ATTTCAGATGAACACATTACTATTAGTCAAATGGAAGAAGCTTTCGAGAAAGGTTTTAAG
    AAAGGTTTAAATATAGAATTAAAGCCACTTGAATTAACAGAAGCTCAATTGGCAGAAGTG
    GAAGAATTAACTGAAAAATATCGTTCAGATGAATGGATGTTTAGAAAGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    831

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1363 [new locus tag: SA_RS07715 ]
  • symbol: SA1363
  • description: hypothetical protein
  • length: 276
  • theoretical pI: 5.15375
  • theoretical MW: 31881.2
  • GRAVY: -0.473913

Function[edit source | edit]

  • reaction:
    EC 2.3.1.181?  ExPASy
    Lipoyl(octanoyl) transferaseOctanoyl-[acyl-carrier-protein] + protein = protein N6-(octanoyl)lysine + [acyl-carrier-protein]
  • TIGRFAM:
    Genetic information processingProtein fateProtein modification and repairlipoyltransferase and lipoate-protein ligase (TIGR00545; HMM-score: 101)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismDehydrogenase complexes Lipoate-protein ligase A
    and 2 more
    Cofactors, Vitamins, Prosthetic Groups, PigmentsLipoic acidLipoic acid metabolism Lipoate-protein ligase A
    Lipoate transport Lipoate-protein ligase A
  • PFAM:
    tRNA_synt_II (CL0040) BPL_LplA_LipB; Biotin/lipoate A/B protein ligase family (PF03099; HMM-score: 95.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002278
    • TAT(Tat/SPI): 0.000151
    • LIPO(Sec/SPII): 0.000409
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTETWNFINTGSKDPYYNMAMDEALLNFVSRGEIDPVIRFYTWNPATLSIGYFQRLQKEIDIDKVKEKGFGLVRRQTGGRGVLHDKELTYSVIVPESHPNMPSTVTEAYRVISQGLLEGFKNLGFDTYFAVPKTPEERQKLKQPRSSVCFDAPSWYELVVEGRKIAGSAQTRQKGVILQHGSILQDIDIDELFDMFIYKNERLKLKMKEAFVEKAVAINDISDEHITISQMEEAFEKGFKKGLNIELKPLELTEAQLAEVEELTEKYRSDEWMFRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA1363 no polycistronic organisation predicted

Regulation[edit source | edit]

  • regulator: CodY (repression) regulon
    CodY(TF)important in Amino acid metabolism; RegPrecise  

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]