From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1412 [new locus tag: SA_RS07970 ]
  • pan locus tag?: SAUPAN004166000
  • symbol: hemN
  • pan gene symbol?: hemN
  • synonym:
  • product: coproporphyrinogen III oxidase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA1412 [new locus tag: SA_RS07970 ]
  • symbol: hemN
  • product: coproporphyrinogen III oxidase
  • replicon: chromosome
  • strand: -
  • coordinates: 1617151..1618275
  • length: 1125
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGACGGTACAAAGTGCATATATACATATTCCATTTTGTGTAAGAATATGTACATATTGT
    GATTTCAATAAATATTTTATACAGAATCAACCTGTAGATGAGTACTTAGATGCACTAATA
    ACAGAAATGTCTACAGCAAAATATAGGAACTTAAAGACCATGTATGTAGGTGGCGGCACA
    CCAACGGCCCTTTCTATTAATCAGTTGGAAAGATTACTTAAAGCAATACGTGATACGTTT
    ACAATCACAGGCGAGTATACATTTGAAGCAAATCCTGATGAGTTAACTAAAGAGAAAGTC
    CAACTATTAGAGAAATATGGAGTAAATAGAATTTCAATGGGCGTTCAAACATTCAAACCG
    GAGTTATTGTCTGTTTTAGGTAGAACGCACAATACTGAAGATATTTACACTTCGGTGTTA
    AATGCTAAAAACGCAGGTATTAAATCAATCAGTTTAGATTTAATGTATCATTTACCGAAA
    CAGACGATTGAAGATTTTGAACAAAGTTTAGATCTAGCTTTAGATATGGATATTCAACAT
    ATTTCGAGTTACGGCTTAATACTTGAACCTAAAACCCAATTTTATAATATGTATAGAAAA
    GGGTTGCTTAAACTTCCTAATGAGGATTTAGGTGCTGACATGTATCAGTTGTTGATGTCT
    AAGATAGAACAATCTCCTTTCCATCAATACGAAATATCTAATTTTGCATTAGATGGCCAT
    GAATCAGAACATAATAAGGTTTACTGGTTTAATGAGGAATATTATGGATTTGGAGCAGGT
    GCAAGTGGTTATGTAGATGGTGTGCGTTATACGAATATCAATCCAGTGAATCATTATATC
    AAAGCTATAAATAAAGAAAGTAAAGCAATTTTAGTATCAAATAAACCTTCTTTGACTGAG
    AGAATGGAAGAAGAAATGTTTCTTGGGTTGCGTTTAAATGAAGGTGTGAGTAGTAGTAGG
    TTCAAAAAGAAGTTTGACCAATCTATTGAAAGTGTCTTTGGTCAAACAATAAATAATTTA
    AAAGAGAAAGAATTAATTGTAGAAAAGAACGATGCGATTGCACTAACAAAGCGAGGGAAA
    GTCATAGGTAATGAGGTTTTTGAAGCTTTCCTAATAAATGATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA1412 [new locus tag: SA_RS07970 ]
  • symbol: HemN
  • description: coproporphyrinogen III oxidase
  • length: 374
  • theoretical pI: 5.31963
  • theoretical MW: 42839.5
  • GRAVY: -0.351872

Function[edit | edit source]

  • reaction:
    EC 1.3.3.3?  ExPASy
    Coproporphyrinogen oxidase Coproporphyrinogen-III + O2 + 2 H+ = protoporphyrinogen-IX + 2 CO2 + 2 H2O
    EC 1.3.99.-?  ExPASy
  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin putative oxygen-independent coproporphyrinogen III oxidase (TIGR00539; EC 1.3.99.22; HMM-score: 379)
    and 21 more
    putative heme utilization radical SAM enzyme HutW (TIGR04107; HMM-score: 210.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin coproporphyrinogen dehydrogenase HemZ (TIGR03994; EC 1.3.99.22; HMM-score: 161.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin oxygen-independent coproporphyrinogen III oxidase (TIGR00538; EC 1.3.99.22; HMM-score: 156.3)
    HemN-related non-iron pseudo-SAM protein PsgB (TIGR04419; HMM-score: 82.8)
    Unknown function Enzymes of unknown specificity B12-binding domain/radical SAM domain protein, MJ_1487 family (TIGR04013; HMM-score: 48.7)
    Unknown function Enzymes of unknown specificity radical SAM protein, TIGR01212 family (TIGR01212; HMM-score: 46)
    Genetic information processing Transcription DNA-dependent RNA polymerase radical SAM enzyme/protein acetyltransferase, ELP3 family (TIGR01211; EC 2.3.1.48; HMM-score: 39.8)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA-i(6)A37 thiotransferase enzyme MiaB (TIGR01574; EC 2.-.-.-; HMM-score: 26.1)
    Unknown function Enzymes of unknown specificity B12-binding domain/radical SAM domain protein, MJ_0865 family (TIGR04014; HMM-score: 25)
    radical SAM methylthiotransferase, MiaB/RimO family (TIGR00089; EC 2.1.1.-,2.8.1.-; HMM-score: 21.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 21.4)
    putative metalloenzyme radical SAM/SPASM domain maturase (TIGR04311; HMM-score: 19.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification MiaB-like tRNA modifying enzyme (TIGR01579; HMM-score: 17.7)
    Cellular processes Cellular processes Toxin production and resistance ribosomal peptide maturation radical SAM protein 1 (TIGR03975; HMM-score: 17.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis protein ThiH (TIGR02351; HMM-score: 17.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone putative menaquinone biosynthesis radical SAM enzyme, SCO4494 family (TIGR03700; HMM-score: 15.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 14.4)
    hopanoid biosynthesis associated radical SAM protein HpnJ (TIGR03471; HMM-score: 13.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 13.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone dehypoxanthine futalosine cyclase (TIGR03699; HMM-score: 12.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase, CofH subunit (TIGR03551; EC 2.5.1.77; HMM-score: 11.1)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, Pigments Tetrapyrroles CPO analysis  Hypothetical radical SAM family enzyme in heat shock gene cluster, similarity with CPO of BS HemN-type
    and 2 more
    Experimental tye  Hypothetical radical SAM family enzyme in heat shock gene cluster, similarity with CPO of BS HemN-type
    Stress Response Heat shock Heat shock dnaK gene cluster extended  Hypothetical radical SAM family enzyme in heat shock gene cluster, similarity with CPO of BS HemN-type
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 75.2)
    and 2 more
    HTH (CL0123) HemN_C; HemN C-terminal domain (PF06969; HMM-score: 55.3)
    4Fe-4S (CL0344) Fer4_14; 4Fe-4S single cluster domain (PF13394; HMM-score: 14.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: [4Fe-4S] cluster
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.019458
    • TAT(Tat/SPI): 0.000182
    • LIPO(Sec/SPII): 0.009979
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTVQSAYIHIPFCVRICTYCDFNKYFIQNQPVDEYLDALITEMSTAKYRNLKTMYVGGGTPTALSINQLERLLKAIRDTFTITGEYTFEANPDELTKEKVQLLEKYGVNRISMGVQTFKPELLSVLGRTHNTEDIYTSVLNAKNAGIKSISLDLMYHLPKQTIEDFEQSLDLALDMDIQHISSYGLILEPKTQFYNMYRKGLLKLPNEDLGADMYQLLMSKIEQSPFHQYEISNFALDGHESEHNKVYWFNEEYYGFGAGASGYVDGVRYTNINPVNHYIKAINKESKAILVSNKPSLTERMEEEMFLGLRLNEGVSSSRFKKKFDQSIESVFGQTINNLKEKELIVEKNDAIALTKRGKVIGNEVFEAFLIND

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]