Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1912 [new locus tag: SA_RS11000 ]
- pan locus tag?: SAUPAN005401000
- symbol: SA1912
- pan gene symbol?: atpI
- synonym:
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1912 [new locus tag: SA_RS11000 ]
- symbol: SA1912
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2161722..2162075
- length: 354
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124813 NCBI
- RefSeq: NP_375217 NCBI
- BioCyc: see SA_RS11000
- MicrobesOnline: 104243 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAGTCGTTTCTACAACATTTTTAAACAGTTCATTCAATATTATTTTTATCTAATAATA
ATATTGGGAGGATTATACCTTTATACACACCATGCATTTATCTTAGGATTAATCATTGGT
GTTACTGGTTCTGCAATCAACACATGTATTTTTGAATGCTATTTAGCTAAAGCTAAAAGA
CCAGACACTATGCATATTTCAACTGGAAATATGTGGCGATACTTAGTTGCAATTATTGCC
TGTATGATTTGGTACCTTAATAAAGCGCATGTAAGTATCATCGGTATAATTATTGGTTTA
ATGATTTCATATGTTGTAGTTATCATACGTCCTTTACTAAAGGTGAGCAAATAA60
120
180
240
300
354
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1912 [new locus tag: SA_RS11000 ]
- symbol: SA1912
- description: hypothetical protein
- length: 117
- theoretical pI: 9.84561
- theoretical MW: 13487.3
- GRAVY: 0.92906
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED :
- ATP synthase protein I
- PFAM: ATPase_I_AtpR (CL0478) ATP-synt_I; ATP synthase I chain (PF03899; HMM-score: 32.1)and 4 moreno clan defined MNHE; Na+/H+ ion antiporter subunit (PF01899; HMM-score: 14.1)GNVR; G-rich domain on putative tyrosine kinase (PF13807; HMM-score: 9.9)Phage_holin_6_1; Bacteriophage holin of superfamily 6 (Holin_LLH) (PF09682; HMM-score: 9.4)RseC_MucC; Positive regulator of sigma(E), RseC/MucC (PF04246; HMM-score: 6.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 4
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9994
- Cell wall & surface Score: 0
- Extracellular Score: 0.0005
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.052139
- TAT(Tat/SPI): 0.001468
- LIPO(Sec/SPII): 0.006078
- predicted transmembrane helices (TMHMM): 4
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSRFYNIFKQFIQYYFYLIIILGGLYLYTHHAFILGLIIGVTGSAINTCIFECYLAKAKRPDTMHISTGNMWRYLVAIIACMIWYLNKAHVSIIGIIIGLMISYVVVIIRPLLKVSK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]