From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2279 [new locus tag: SA_RS13075 ]
  • pan locus tag?: SAUPAN006091000
  • symbol: SA2279
  • pan gene symbol?: pgcA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2279 [new locus tag: SA_RS13075 ]
  • symbol: SA2279
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2555052..2556803
  • length: 1752
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    GTGTTTTTTTACTTTTGGGGCGTATTTCTTTATAATTCATTACATAAATGTAAGGGCTTT
    AGTTTTCATGTTTTATTAAGTCTAACTGAGATTTTGAAAGGATGTTTAGCAACAATGGAT
    AAAGAATTATGGATAGAAAGAGCTAATGATAGTTTAGTTAAACATTTTTATGAGCAGCAA
    TCTGACATTGAACAGCGAGAAGGTTTTGAAAGTAAATTAACATTTGGTACTGCGGGTATA
    CGCGGAAAATTCGGTCTTGGTGAAGGTCGACTTAATAAGTTTACTATTGAAAAATTGGCA
    TTAGGTTTAGCGCGTTATTTAAATGCCCAAACAAACAGTCCAACAATAGTCATTCATTAT
    GATATTAGACATCTTTCAACTGAATTCGCCCAAATTATTGCTAATGTATTAGCAAACCAT
    CAAATAACAGTTTATTTACCTGATACATATAAAACGACACCGGAATTATCGTTCGCGGTT
    CGCAATCTTAATACTACTGCCGGCATTATGATTACAGCAAGTCATAATCCGAAAGACTAT
    AACGGCATTAAAGTATATGGTTCTGATGGCGCGCAATTATCGACTGATGCATCTGAGCTT
    GCAAGTCGTTATATCGAAGAAGTTGGCGATCCATTACAGATTGATATACCTATTTCAAAA
    CAAAATACATCTTATATCAAACCTTTTCCGAAATCTGTAACTGATGACTATATGAAACAC
    ATTCAAAATATGATTGGCTATATTCCTAAATCTGATTTACAAGTTGTGTTCACTAGTTTG
    CATGGTACAAGTGTTCCAATTGTACCTGAGTTATTAAAATCTTTGAATTTCAATCAATTT
    AATCTTGTAGATGCACAATGTAAACCTGATCCGAATTTTAGTTCAGTTCAAAGTGCTAAT
    CCTGAAGATCATCGCGCTTTTGATCAAGCAGTCGAACTTGCAAATAAAAGTCATGCAGAC
    TTATTAATATCAACTGACCCAGATGCAGATCGACTTGGTATTGCTGAACGTGATGCACAT
    GGTCATATCACATATTTTAATGGCAACCAAATTGGTGCGCTGTTACTTAATTATCGTATT
    CAACAAACGTCTCAATTACGTCACCGCTTAATGATTCAATCTATTGTAAGTAGTGAGTTA
    ACAAAGTCATTAGCACGCTATAATAATGTTAAATACAAAGAGGTACTGACGGGCTTTAAA
    TTTATTGCTCAGGAAATAAGACAACTGGATGATCATCAAAATATGATTTTCGCATTTGAA
    GAGAGTTACGGTTTTCTATCAGAGCCTTTTGTACGTGATAAAGATGCCGTACAAATTGTG
    CCACTCATTATAAAATACGCTTCTGAGTTAAAATTATATGGCAAAACATTGAAAGATGAA
    TTAGAACAGATTTATCAAACTGTTGGTAGACATGAGGATACATTATTCTCGCATACGCTA
    GAAGGATTAGAAGGTAAGAAAAAAATTGAATCAATTATGACACATTTCCGTTCAAATCCA
    CCGCAAGAGATTCAAGGACTGAAAGTGAAAGCAATTGAAGATTATTTAACTAGCGAGGTT
    TATCATTTGGATAAAGATACAACGTCACAGATTAATTCTTCTAAATCAAATGTTATTCGT
    GTCTTATTTGACGAAGGATTTATCGCTTTACGTCCTTCTGGTACTGAACCTAAAATTAAA
    TTATATGTGTCGTTAAAATGTCCGGATTTTGATGATGTAGCTCAAAAAATTAATGCGATG
    ATTTTTAGCTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1752

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2279 [new locus tag: SA_RS13075 ]
  • symbol: SA2279
  • description: hypothetical protein
  • length: 583
  • theoretical pI: 6.47208
  • theoretical MW: 66097.7
  • GRAVY: -0.286621

Function[edit | edit source]

  • reaction:
    EC 5.4.2.2?  ExPASy
    Phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) Alpha-D-glucose 1-phosphate = alpha-D-glucose 6-phosphate
  • TIGRFAM:
    Metabolism Central intermediary metabolism Amino sugars phosphoglucosamine mutase (TIGR03990; EC 5.4.2.10; HMM-score: 171.7)
    and 3 more
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan phosphoglucosamine mutase (TIGR01455; EC 5.4.2.10; HMM-score: 98.1)
    Metabolism Central intermediary metabolism Amino sugars phosphoglucosamine mutase (TIGR01455; EC 5.4.2.10; HMM-score: 98.1)
    Metabolism Energy metabolism Sugars phosphoglucomutase, alpha-D-glucose phosphate-specific (TIGR01132; EC 5.4.2.2; HMM-score: 74.7)
  • TheSEED:  
    Carbohydrates Monosaccharides Mannose Metabolism  Phosphomannomutase (EC 5.4.2.8)
    and 2 more
    Cell Wall and Capsule Capsular and extracellular polysacchrides Sialic Acid Metabolism  Phosphoglucosamine mutase (EC 5.4.2.10)
    Cell Wall and Capsule - no subcategory UDP-N-acetylmuramate from Fructose-6-phosphate Biosynthesis  Phosphoglucosamine mutase (EC 5.4.2.10)
  • PFAM:
    no clan defined PGM_PMM_I; Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I (PF02878; HMM-score: 142.2)
    and 5 more
    PGM_PMM_II; Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II (PF02879; HMM-score: 92.4)
    PGM_PMM_III; Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III (PF02880; HMM-score: 57.1)
    PGM_PMM_IV; Phosphoglucomutase/phosphomannomutase, C-terminal domain (PF00408; HMM-score: 31.9)
    Peptidase_MH (CL0035) Amidase_3; N-acetylmuramoyl-L-alanine amidase (PF01520; HMM-score: 12.7)
    no clan defined PPP4R2; PPP4R2 (PF09184; HMM-score: 12.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.111758
    • TAT(Tat/SPI): 0.002017
    • LIPO(Sec/SPII): 0.33133
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MFFYFWGVFLYNSLHKCKGFSFHVLLSLTEILKGCLATMDKELWIERANDSLVKHFYEQQSDIEQREGFESKLTFGTAGIRGKFGLGEGRLNKFTIEKLALGLARYLNAQTNSPTIVIHYDIRHLSTEFAQIIANVLANHQITVYLPDTYKTTPELSFAVRNLNTTAGIMITASHNPKDYNGIKVYGSDGAQLSTDASELASRYIEEVGDPLQIDIPISKQNTSYIKPFPKSVTDDYMKHIQNMIGYIPKSDLQVVFTSLHGTSVPIVPELLKSLNFNQFNLVDAQCKPDPNFSSVQSANPEDHRAFDQAVELANKSHADLLISTDPDADRLGIAERDAHGHITYFNGNQIGALLLNYRIQQTSQLRHRLMIQSIVSSELTKSLARYNNVKYKEVLTGFKFIAQEIRQLDDHQNMIFAFEESYGFLSEPFVRDKDAVQIVPLIIKYASELKLYGKTLKDELEQIYQTVGRHEDTLFSHTLEGLEGKKKIESIMTHFRSNPPQEIQGLKVKAIEDYLTSEVYHLDKDTTSQINSSKSNVIRVLFDEGFIALRPSGTEPKIKLYVSLKCPDFDDVAQKINAMIFS

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SA2279 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)

Relevant publications[edit | edit source]