From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
  • pan locus tag?: SAUPAN004447000
  • symbol: SACOL1811
  • pan gene symbol?:
  • synonym: mnmM
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
  • symbol: SACOL1811
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1867762..1868325
  • length: 564
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAATTAGAACGTATACTCCCTTTTTCAAAAACACTTATTAAACAACATATAACACCA
    GAAAGTATTGTTGTAGACGCAACTTGCGGTAACGGCAATGACACTTTATTTTTAGCCGAA
    CAAGTACCAGAAGGACATGTTTATGGTTTCGACATTCAAGATTTAGCTTTGGAAAATACA
    CGTGATAAAGTTAAGGATTTCAATCATGTTTCTTTAATAAAAGATGGACATGAAAATATT
    GAACATCATATAAATGATGCACATAAAGGTCATATTGATGCAGCCATCTTTAACCTAGGT
    TATTTGCCTAAAGGTGATAAATCTATCGTGACAAAGCCTGACACGACAATCCAAGCTATT
    AATTCATTGCTATCATTAATGTCAATTGAAGGTATTATTGTACTTGTTATATATCATGGT
    CATAGCGAAGGACAAATTGAGAAGCATGCATTGCTTGATTACTTGAGTACTTTGGATCAA
    AAGCATGCGCAAGTTTTGCAATATCAATTTTTAAACCAACGTAATCATGCTCCATTCATT
    TGTGCCATAGAAAAAATTTCTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    564


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
  • symbol: SACOL1811
  • description: hypothetical protein
  • length: 187
  • theoretical pI: 6.31001
  • theoretical MW: 20992.8
  • GRAVY: -0.181283

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification 16S rRNA (cytosine(1402)-N(4))-methyltransferase (TIGR00006; EC 2.1.1.199; HMM-score: 31)
    and 10 more
    Genetic information processing Protein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 21.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone demethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 20.5)
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification putative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 20.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 19.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 15.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 15)
    2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 14.8)
    Unknown function Enzymes of unknown specificity tRNA (cmo5U34)-methyltransferase (TIGR00740; EC 2.1.1.-; HMM-score: 14.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 11.4)
  • TheSEED  :
    • Putative rRNA methylase YtqB
  • PFAM:
    NADP_Rossmann (CL0063) rRNA_methylase; Putative rRNA methylase (PF06962; HMM-score: 167)
    and 12 more
    Methyltransf_5; MraW methylase family (PF01795; HMM-score: 36.7)
    Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 35.1)
    Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 32.7)
    Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 23.5)
    MTS; Methyltransferase small domain (PF05175; HMM-score: 20)
    FtsJ; FtsJ-like methyltransferase (PF01728; HMM-score: 18.4)
    Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 17.5)
    Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 17.4)
    Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 15.2)
    TPMT; Thiopurine S-methyltransferase (TPMT) (PF05724; HMM-score: 14.3)
    Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 13.9)
    GCD14; tRNA methyltransferase complex GCD14 subunit (PF08704; HMM-score: 12.8)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9977
    • Cytoplasmic Membrane Score: 0.0004
    • Cell wall & surface Score: 0.0004
    • Extracellular Score: 0.0015
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.011503
    • TAT(Tat/SPI): 0.000528
    • LIPO(Sec/SPII): 0.014606
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MKLERILPFSKTLIKQHITPESIVVDATCGNGNDTLFLAEQVPEGHVYGFDIQDLALENTRDKVKDFNHVSLIKDGHENIEHHINDAHKGHIDAAIFNLGYLPKGDKSIVTKPDTTIQAINSLLSLMSIEGIIVLVIYHGHSEGQIEKHALLDYLSTLDQKHAQVLQYQFLNQRNHAPFICAIEKIS

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]