Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
- pan locus tag?: SAUPAN004447000
- symbol: SACOL1811
- pan gene symbol?: —
- synonym: mnmM
- product: hypothetical protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
- symbol: SACOL1811
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1867762..1868325
- length: 564
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238704 NCBI
- RefSeq: YP_186644 NCBI
- BioCyc: see SACOL_RS09280
- MicrobesOnline: 913255 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541ATGAAATTAGAACGTATACTCCCTTTTTCAAAAACACTTATTAAACAACATATAACACCA
GAAAGTATTGTTGTAGACGCAACTTGCGGTAACGGCAATGACACTTTATTTTTAGCCGAA
CAAGTACCAGAAGGACATGTTTATGGTTTCGACATTCAAGATTTAGCTTTGGAAAATACA
CGTGATAAAGTTAAGGATTTCAATCATGTTTCTTTAATAAAAGATGGACATGAAAATATT
GAACATCATATAAATGATGCACATAAAGGTCATATTGATGCAGCCATCTTTAACCTAGGT
TATTTGCCTAAAGGTGATAAATCTATCGTGACAAAGCCTGACACGACAATCCAAGCTATT
AATTCATTGCTATCATTAATGTCAATTGAAGGTATTATTGTACTTGTTATATATCATGGT
CATAGCGAAGGACAAATTGAGAAGCATGCATTGCTTGATTACTTGAGTACTTTGGATCAA
AAGCATGCGCAAGTTTTGCAATATCAATTTTTAAACCAACGTAATCATGCTCCATTCATT
TGTGCCATAGAAAAAATTTCTTAA60
120
180
240
300
360
420
480
540
564
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1811 [new locus tag: SACOL_RS09280 ]
- symbol: SACOL1811
- description: hypothetical protein
- length: 187
- theoretical pI: 6.31001
- theoretical MW: 20992.8
- GRAVY: -0.181283
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis tRNA and rRNA base modification 16S rRNA (cytosine(1402)-N(4))-methyltransferase (TIGR00006; EC 2.1.1.199; HMM-score: 31)and 10 moreProtein fate Protein modification and repair protein-(glutamine-N5) methyltransferase, release factor-specific (TIGR03534; EC 2.1.1.-; HMM-score: 21.7)Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin precorrin-6Y C5,15-methyltransferase (decarboxylating), CbiT subunit (TIGR02469; EC 2.1.1.132; HMM-score: 20.7)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone demethylmenaquinone methyltransferase (TIGR02752; EC 2.1.1.163; HMM-score: 20.5)Protein synthesis Ribosomal proteins: synthesis and modification putative protein-(glutamine-N5) methyltransferase, unknown substrate-specific (TIGR03704; EC 2.1.1.-; HMM-score: 20.5)Protein synthesis tRNA and rRNA base modification 23S rRNA (uracil-5-)-methyltransferase RumA (TIGR00479; EC 2.1.1.-; HMM-score: 19.9)Biosynthesis of cofactors, prosthetic groups, and carriers Biotin malonyl-acyl carrier protein O-methyltransferase BioC (TIGR02072; EC 2.1.1.-; HMM-score: 15.9)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone/menaquinone biosynthesis methyltransferase (TIGR01934; EC 2.1.1.-; HMM-score: 15)2-ketoarginine methyltransferase (TIGR04543; EC 2.1.1.243; HMM-score: 14.8)Unknown function Enzymes of unknown specificity tRNA (cmo5U34)-methyltransferase (TIGR00740; EC 2.1.1.-; HMM-score: 14.3)Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium protoporphyrin O-methyltransferase (TIGR02021; EC 2.1.1.11; HMM-score: 11.4)
- TheSEED :
- Putative rRNA methylase YtqB
- PFAM: NADP_Rossmann (CL0063) rRNA_methylase; Putative rRNA methylase (PF06962; HMM-score: 167)and 12 moreMethyltransf_5; MraW methylase family (PF01795; HMM-score: 36.7)Methyltransf_31; Methyltransferase domain (PF13847; HMM-score: 35.1)Methyltransf_25; Methyltransferase domain (PF13649; HMM-score: 32.7)Methyltransf_12; Methyltransferase domain (PF08242; HMM-score: 23.5)MTS; Methyltransferase small domain (PF05175; HMM-score: 20)FtsJ; FtsJ-like methyltransferase (PF01728; HMM-score: 18.4)Methyltransf_32; Methyltransferase domain (PF13679; HMM-score: 17.5)Methyltransf_11; Methyltransferase domain (PF08241; HMM-score: 17.4)Methyltransf_23; Methyltransferase domain (PF13489; HMM-score: 15.2)TPMT; Thiopurine S-methyltransferase (TPMT) (PF05724; HMM-score: 14.3)Methyltransf_4; Putative methyltransferase (PF02390; HMM-score: 13.9)GCD14; tRNA methyltransferase complex GCD14 subunit (PF08704; HMM-score: 12.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9977
- Cytoplasmic Membrane Score: 0.0004
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0015
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.011503
- TAT(Tat/SPI): 0.000528
- LIPO(Sec/SPII): 0.014606
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKLERILPFSKTLIKQHITPESIVVDATCGNGNDTLFLAEQVPEGHVYGFDIQDLALENTRDKVKDFNHVSLIKDGHENIEHHINDAHKGHIDAAIFNLGYLPKGDKSIVTKPDTTIQAINSLLSLMSIEGIIVLVIYHGHSEGQIEKHALLDYLSTLDQKHAQVLQYQFLNQRNHAPFICAIEKIS
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)