From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
  • pan locus tag?: SAUPAN005291000
  • symbol: SACOL2035
  • pan gene symbol?: rex
  • synonym:
  • product: redox-sensing transcriptional repressor Rex

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
  • symbol: SACOL2035
  • product: redox-sensing transcriptional repressor Rex
  • replicon: chromosome
  • strand: -
  • coordinates: 2093109..2093744
  • length: 636
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAGTGACCAAGTTAAAATTCCTCGAGCAACTTTAAAACGTTTGCCGTTATATTATAGA
    TTTGTCAGTTCATTAAAATCTAAAGGTATAGATCGTGTAAATTCAAAAGCGATTAGCGAT
    GCGTTACAAATTGACTCGGCAACAATTCGTCGTGACTTTTCATATTTTGGCGAATTAGGT
    AAAAAAGGGTACGGATATAATATAGATAGTTTATTGGATTTCTTTAAATCTGAACTAAGC
    GAGAGTGACATGATCAAAATCGCAATTGTCGGAGTTGGGAACCTAGGGAAAGCTTTGCTC
    ACATATAACTTTTCAATACATGACGATATGACGATTACAGAAGCGTTTGACGTAAAAGAA
    GATGTTATTGGCCAGAAAATAGGGAACGTTATTGTTAAAGATAACGATGAATTAATAACA
    ACATTGAAGAAGGAAGAAATAGATGTTGTGATTCTAACTACACCAGAAAGAGTTGCACAG
    AAAGTTGCAGATGAACTCGTCCAAGCTGGTGTGAAAGGTATTTTAAACTTCACTCCTGGT
    AGAATTAATACGCCTTCAGATGTGCAAGTACATCAAATTGACTTAGGTATAGAATTACAG
    TCATTATTATTCTTTATGAAAAATTACAGTGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    636


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2035 [new locus tag: SACOL_RS10620 ]
  • symbol: SACOL2035
  • description: redox-sensing transcriptional repressor Rex
  • length: 211
  • theoretical pI: 5.12384
  • theoretical MW: 23598.9
  • GRAVY: -0.0995261

Function[edit | edit source]

  • TIGRFAM:
    diaminopimelate dehydrogenase (TIGR01921; EC 1.4.1.16; HMM-score: 21.3)
    Metabolism Amino acid biosynthesis Glutamate family N-acetyl-gamma-glutamyl-phosphate reductase (TIGR01850; EC 1.2.1.38; HMM-score: 19.5)
    Metabolism Amino acid biosynthesis Aspartate family 4-hydroxy-tetrahydrodipicolinate reductase (TIGR00036; EC 1.17.1.8; HMM-score: 17.4)
    Metabolism Energy metabolism Sugars inositol 2-dehydrogenase (TIGR04380; EC 1.1.1.18; HMM-score: 17.3)
    and 7 more
    sugar O-acyltransferase, sialic acid O-acetyltransferase NeuD family (TIGR03570; HMM-score: 15.8)
    Metabolism Amino acid biosynthesis Glutamate family pyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 14.8)
    acetaldehyde dehydrogenase (acetylating) (TIGR03215; EC 1.2.1.10; HMM-score: 14.2)
    acetyl coenzyme A synthetase (ADP forming), alpha domain (TIGR02717; EC 6.2.1.13; HMM-score: 14.1)
    undecaprenyl-phosphate glucose phosphotransferase (TIGR03023; EC 2.7.8.-; HMM-score: 13.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides cellulose synthase operon protein YhjU (TIGR03368; HMM-score: 12.2)
    exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase (TIGR03025; HMM-score: 12)
  • TheSEED  :
    • Redox-sensing transcriptional repressor Rex
    Stress Response Oxidative stress Oxidative stress  Redox-sensitive transcriptional regulator (AT-rich DNA-binding protein)
  • PFAM:
    NADP_Rossmann (CL0063) CoA_binding; CoA binding domain (PF02629; HMM-score: 92.3)
    and 9 more
    HTH (CL0123) Put_DNA-bind_N; Putative DNA-binding protein N-terminus (PF06971; HMM-score: 69.5)
    NADP_Rossmann (CL0063) Semialdhyde_dh; Semialdehyde dehydrogenase, NAD binding domain (PF01118; HMM-score: 24)
    GFO_IDH_MocA; Oxidoreductase family, NAD-binding Rossmann fold (PF01408; HMM-score: 22.9)
    F420_oxidored; NADP oxidoreductase coenzyme F420-dependent (PF03807; HMM-score: 18.7)
    GARS_N; Phosphoribosylglycinamide synthetase, N domain (PF02844; HMM-score: 15.7)
    HTH (CL0123) HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 15.6)
    NADP_Rossmann (CL0063) CoA_binding_2; CoA binding domain (PF13380; HMM-score: 15.5)
    no clan defined Packaging_FI; DNA packaging protein FI (PF14000; HMM-score: 15.5)
    MTD; methylene-5,6,7,8-tetrahydromethanopterin dehydrogenase (PF01993; HMM-score: 12.4)

Structure, modifications & cofactors[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9836
    • Cytoplasmic Membrane Score: 0.0072
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.009
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007572
    • TAT(Tat/SPI): 0.000828
    • LIPO(Sec/SPII): 0.001442
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MSDQVKIPRATLKRLPLYYRFVSSLKSKGIDRVNSKAISDALQIDSATIRRDFSYFGELGKKGYGYNIDSLLDFFKSELSESDMIKIAIVGVGNLGKALLTYNFSIHDDMTITEAFDVKEDVIGQKIGNVIVKDNDELITTLKKEEIDVVILTTPERVAQKVADELVQAGVKGILNFTPGRINTPSDVQVHQIDLGIELQSLLFFMKNYSE

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 242 [4]
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 32.56 h [5]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Martin Pagels, Stephan Fuchs, Jan Pané-Farré, Christian Kohler, Leonhard Menschner, Michael Hecker, Peter J McNamarra, Mikael C Bauer, Claes von Wachenfeldt, Manuel Liebeke, Michael Lalk, Gunnar Sander, Christof von Eiff, Richard A Proctor, Susanne Engelmann
Redox sensing by a Rex-family repressor is involved in the regulation of anaerobic gene expression in Staphylococcus aureus.
Mol Microbiol: 2010, 76(5);1142-61
[PubMed:20374494] [WorldCat.org] [DOI] (I p)