From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2311 [new locus tag: SACOL_RS12155 ]
  • pan locus tag?: SAUPAN005798000
  • symbol: SACOL2311
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2311 [new locus tag: SACOL_RS12155 ]
  • symbol: SACOL2311
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2373114..2373299
  • length: 186
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    ATGACAACAGCATTAATTGGTGTAATTGTATTAATCTTACTAATTATTAGCTTTGTGCCA
    AACTACCGTGCTATGAAATCAGCAAAAGAACAAGGAAGTAATGCAACAAGAGCTACAATT
    ATGGTAGGCATAGATATTATCTTAATTGTACTTATCATCGTGACGTTATTATTAAAATAT
    ATGTAA
    60
    120
    180
    186

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL2311 [new locus tag: SACOL_RS12155 ]
  • symbol: SACOL2311
  • description: hypothetical protein
  • length: 61
  • theoretical pI: 10.3246
  • theoretical MW: 6675.29
  • GRAVY: 1.36557

⊟Function[edit | edit source]

  • TIGRFAM:
    variant surface antigen, rifin family (TIGR01477; HMM-score: 5.9)
  • TheSEED  :
    • Hypothetical protein SAV2318
  • PFAM:
    no clan defined DUF3149; Protein of unknown function (DUF3149) (PF11346; HMM-score: 11.3)
    Omega_toxin (CL0083) Chi-conotoxin; chi-Conotoxin or t superfamily (PF16981; HMM-score: 10.3)
    no clan defined P12; Virus attachment protein p12 family (PF12669; HMM-score: 9.6)
    OppC_N; N-terminal TM domain of oligopeptide transport permease C (PF12911; HMM-score: 9.2)
    and 3 more
    Adeno_E3_CR2; Adenovirus E3 region protein CR2 (PF02439; HMM-score: 9)
    Zn_Beta_Ribbon (CL0167) DUF2116; Uncharacterized protein containing a Zn-ribbon (DUF2116) (PF09889; HMM-score: 7.3)
    VSA (CL0656) RIFIN; Rifin (PF02009; HMM-score: 6.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.054124
    • TAT(Tat/SPI): 0.000861
    • LIPO(Sec/SPII): 0.059842
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MTTALIGVIVLILLIISFVPNYRAMKSAKEQGSNATRATIMVGIDIILIVLIIVTLLLKYM

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SACOL2311&oldid=91309"