From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2645 [new locus tag: SACOL_RS13855 ]
  • pan locus tag?: SAUPAN006337000
  • symbol: nsaS
  • pan gene symbol?: nsaS
  • synonym: braS
  • product: nisin susceptibility-associated sensor histidine kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2645 [new locus tag: SACOL_RS13855 ]
  • symbol: nsaS
  • product: nisin susceptibility-associated sensor histidine kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2705765..2706652
  • length: 888
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACCTTTCTTAAAAGTATTACTCAGGAAATAGCAATAGTCATAGTTATTTTTGCTTTG
    TTTGGCTTAATGTTTTACCTGTATCATTTGCCATTAGAAGCATATTTACTAGCACTTGGC
    GTTATTTTATTATTATTACTCATATTCATAGGTATTAAATATTTAAGTTTTGTAAAAACT
    ATAAGCCAACAACAACAAATTGAAAACTTAGAAAATGCGTTGTATCAGCTTAAAAATGAA
    CAAATTGAATATAAAAATGATGTAGAGAGCTACTTTTTAACATGGGTACATCAAATGAAA
    ACACCCATTACTGCAGCACAACTGTTACTTGAAAGAGATGAGCCTAATGTTGTTAATCGT
    GTTCGTCAAGAGGTTATTCAAATTGATAACTATACAAGTTTAGCACTTAGTTATTTAAAG
    TTATTAAATGAAACTTCTGATATTTCTGTCACTAAAATTTCGATTAATAATATCATTCGC
    CCAATTATTATGAAATATTCAATACAGTTTATTGATCAAAAAACAAAAATCCATTATGAA
    CCTTGTCATCACGAAGTATTAACTGACGTTAGATGGACCTCTTTAATGATAGAACAATTA
    ATAAATAATGCACTTAAGTATGCGAGAGGTAAAGATATATGGATTGAATTTGATGAGCAA
    TCCAATCAATTACACGTAAAAGATAATGGTATCGGTATTAGTGAAGCGGACTTGCCTAAA
    ATATTTGATAAGGGCTATTCAGGTTATAATGGCCAGCGCCAAAGTAACTCAAGTGGGATT
    GGTTTATTTATCGTAAAACAAATTTCAACACACACAAACCATCCTGTTTCAGTCGTATCT
    AAACAAAATGAGGGTACAACATTTACGATTCAATTTCCAGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    888

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2645 [new locus tag: SACOL_RS13855 ]
  • symbol: NsaS
  • description: nisin susceptibility-associated sensor histidine kinase
  • length: 295
  • theoretical pI: 6.09533
  • theoretical MW: 34019
  • GRAVY: -0.0125424

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Signal transduction Two-component systems phosphate regulon sensor kinase PhoR (TIGR02966; EC 2.7.3.-; HMM-score: 62.9)
    and 8 more
    heavy metal sensor kinase (TIGR01386; EC 2.7.13.3; HMM-score: 49.3)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 43.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 31.3)
    Signal transduction Signal transduction Two-component systems putative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 31.3)
    Metabolism Central intermediary metabolism Nitrogen fixation nitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 30.3)
    Signal transduction Regulatory functions Protein interactions nitrogen fixation negative regulator NifL (TIGR02938; HMM-score: 30.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA mismatch repair protein MutL (TIGR00585; HMM-score: 20.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA topoisomerase VI, B subunit (TIGR01052; EC 5.99.1.3; HMM-score: 17.5)
  • TheSEED:  
    Putative two-component sensor histidine kinase
  • PFAM:
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 73.1)
    and 10 more
    HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 26.9)
    HATPase_c_2; Histidine kinase-like ATPase domain (PF13581; HMM-score: 14.7)
    no clan defined DUF1043; Protein of unknown function (DUF1043) (PF06295; HMM-score: 14.6)
    Phage_holin_3_6; Putative Actinobacterial Holin-X, holin superfamily III (PF07332; HMM-score: 14.5)
    FtsL (CL0225) DivIC; Septum formation initiator (PF04977; HMM-score: 13.8)
    C_Lectin (CL0056) Ly49; Ly49-like protein, N-terminal region (PF08391; HMM-score: 13.6)
    His_Kinase_A (CL0025) HisKA; His Kinase A (phospho-acceptor) domain (PF00512; HMM-score: 12.5)
    no clan defined DUF4131; Domain of unknown function (DUF4131) (PF13567; HMM-score: 11.8)
    IncA; IncA protein (PF04156; HMM-score: 6.9)
    DUF3290; Protein of unknown function (DUF3290) (PF11694; HMM-score: 6.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000379
    • TAT(Tat/SPI): 0.000142
    • LIPO(Sec/SPII): 0.013345
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTFLKSITQEIAIVIVIFALFGLMFYLYHLPLEAYLLALGVILLLLLIFIGIKYLSFVKTISQQQQIENLENALYQLKNEQIEYKNDVESYFLTWVHQMKTPITAAQLLLERDEPNVVNRVRQEVIQIDNYTSLALSYLKLLNETSDISVTKISINNIIRPIIMKYSIQFIDQKTKIHYEPCHHEVLTDVRWTSLMIEQLINNALKYARGKDIWIEFDEQSNQLHVKDNGIGISEADLPKIFDKGYSGYNGQRQSNSSGIGLFIVKQISTHTNHPVSVVSKQNEGTTFTIQFPDE

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
    experimental localization: Integral membrane [1] [2]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]