From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS00600 [old locus tag: SACOL0120 ]
  • pan locus tag?: SAUPAN000946000
  • symbol: SACOL_RS00600
  • pan gene symbol?:
  • synonym:
  • product: GntR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS00600 [old locus tag: SACOL0120 ]
  • symbol: SACOL_RS00600
  • product: GntR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 135283..136038
  • length: 756
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (135283..136038) NCBI
  • BioCyc: G1G4B-124 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGAGGTTGTCTACGTGACGCAAACACAACCAAAATTTTTAACGATTTATAATACGTTA
    TATAAAGAAATTCAAATAGGAAAATATCCGAGTGGCCATGCATTACCTACTGAAAAGGAA
    CTTTGTGCGCGCTTTGATGTCAGTCGTATGACTTTGCGCCAAGCTATAAAATTGTTAGCC
    GAAGATGGCATCGTAGAGAGTACAAGAGGGAAGGGACACTTTGTTATTCCACAAACAAAT
    GCCCAACACGCTTCAAGTATGGATCAATTTAAGCATCCACTTGATCAAATATTGCTAGCT
    CGCGTATCTATGTCATCAATTAATTATCGTGTTGATTTAGAAAGTGAATATACAAATCAT
    TTGTTTGCAAACCATCCTTCTGCCGTCATTGCAATGGAACGCTATTATCAAAAAAAGGAC
    AATCATTCTAAGCAAGCTGATGCATTTTGCTTTACCTTTATACCGTTAAATGTCATTGAC
    ACATTTAAAGTGAATACACAAAACGAAGACGACATGAAGACATTCGTTGAGCAAACGATT
    TATAGCAATGCATATCAATCAGATTTAAAAATGTCTATTACCAAAGCGCCCCACTTCAAA
    AATCATAGTCACGTGTTTGATGGTGATACACATTGTTGGCTGATTATTGAAACACTGTAC
    GCACAAACACCTTATCCAATTATGATTAATAAGTGGTATATTCCACAGGAAATATCTGAA
    TTAACACTGACACGTATAAGACAATCGGATTATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS00600 [old locus tag: SACOL0120 ]
  • symbol: SACOL_RS00600
  • description: GntR family transcriptional regulator
  • length: 251
  • theoretical pI: 6.9119
  • theoretical MW: 29171
  • GRAVY: -0.41992

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions trehalose operon repressor (TIGR02404; HMM-score: 68.1)
    Metabolism Transport and binding proteins Anions phosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 55.9)
    Signal transduction Regulatory functions DNA interactions phosphonate metabolism transcriptional regulator PhnF (TIGR02325; HMM-score: 55.9)
    Metabolism Energy metabolism Amino acids and amines histidine utilization repressor (TIGR02018; HMM-score: 55)
    Signal transduction Regulatory functions DNA interactions histidine utilization repressor (TIGR02018; HMM-score: 55)
    and 7 more
    Signal transduction Regulatory functions DNA interactions phosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 42)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis fatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    Metabolism Fatty acid and phospholipid metabolism Degradation fatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    Signal transduction Regulatory functions DNA interactions fatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 35.8)
    phosphonate utilization associated transcriptional regulator (TIGR03338; HMM-score: 24.7)
    Unknown function General Rrf2 family protein (TIGR00738; HMM-score: 14.9)
    Signal transduction Regulatory functions DNA interactions biotin operon repressor (TIGR00122; HMM-score: 12.7)
  • TheSEED:
  • PFAM:
    HTH (CL0123) GntR; Bacterial regulatory proteins, gntR family (PF00392; HMM-score: 62.7)
    and 12 more
    HTH_11; HTH domain (PF08279; HMM-score: 29.2)
    Rrf2; Transcriptional regulator (PF02082; HMM-score: 21.6)
    HTH_20; Helix-turn-helix domain (PF12840; HMM-score: 20.8)
    HTH_DeoR; DeoR-like helix-turn-helix domain (PF08220; HMM-score: 20)
    HTH_41; Helix-turn-helix domain (PF14502; HMM-score: 17)
    MarR_2; MarR family (PF12802; HMM-score: 16.5)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 13.9)
    HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 13.8)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 13.7)
    no clan defined PASTA; PASTA domain (PF03793; HMM-score: 13.4)
    HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 13.2)
    HTH_29; Winged helix-turn helix (PF13551; HMM-score: 12.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00499
    • TAT(Tat/SPI): 0.000149
    • LIPO(Sec/SPII): 0.000385
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_001789411 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MEVVYVTQTQPKFLTIYNTLYKEIQIGKYPSGHALPTEKELCARFDVSRMTLRQAIKLLAEDGIVESTRGKGHFVIPQTNAQHASSMDQFKHPLDQILLARVSMSSINYRVDLESEYTNHLFANHPSAVIAMERYYQKKDNHSKQADAFCFTFIPLNVIDTFKVNTQNEDDMKTFVEQTIYSNAYQSDLKMSITKAPHFKNHSHVFDGDTHCWLIIETLYAQTPYPIMINKWYIPQEISELTLTRIRQSDY

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]