From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03185 [old locus tag: SACOL0616 ]
  • pan locus tag?: SAUPAN002346000
  • symbol: SACOL_RS03185
  • pan gene symbol?: nagB
  • synonym:
  • product: glucosamine-6-phosphate deaminase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS03185 [old locus tag: SACOL0616 ]
  • symbol: SACOL_RS03185
  • product: glucosamine-6-phosphate deaminase
  • replicon: chromosome
  • strand: +
  • coordinates: 649523..650281
  • length: 759
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (649523..650281) NCBI
  • BioCyc: G1G4B-660 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAAAGTATTAAACTTAGGATCGAAAAAACAAGCATCATTCTATGTTGCATGTGAGTTA
    TATAAAGAGATGGCATTTAATCAGCACTGTAAACTAGGTTTAGCAACTGGTGGTACAATG
    ACAGATTTGTATGAACAACTTGTTAAGTTATTAAATAAAAATCAGTTAAACGTAGACAAT
    GTATCCACGTTTAATTTAGACGAATATGTAGGTTTAACCGCATCACATCCGCAAAGTTAT
    CACTATTATATGGATGACATGCTTTTCAAACAATATCCTTATTTTAATAGAAAGAACATT
    CATATTCCAAATGGAGATGCCGATGATATGAATGCGGAAGCGTCAAAATATAATGACGTT
    TTAGAACAACAAGGTCAACGTGATATTCAAATTTTAGGTATTGGTGAAAATGGTCATATT
    GGATTTAATGAACCTGGTACGCCGTTTGATAGCGTTACTCATATCGTTGATTTGACTGAA
    AGTACTATTAAGGCTAATAGTCGATATTTTAAAAACGAAGATGATGTTCCAAAGCAAGCC
    ATTTCGATGGGACTTGCTAATATTCTTCAAGCCAAACGTATCATTTTACTCGCATTTGGT
    GAAAAGAAACGTGCTGCTATTACACATTTATTAAATCAGGAAATTTCTGTTGATGTTCCA
    GCCACATTACTTCACAAACACCCGAATGTTGAGATATATTTAGACGACGAAGCTTGCCCG
    AAAAATGTTGCGAAAATTCATGTCGATGAAATGGATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    759

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS03185 [old locus tag: SACOL0616 ]
  • symbol: SACOL_RS03185
  • description: glucosamine-6-phosphate deaminase
  • length: 252
  • theoretical pI: 5.53277
  • theoretical MW: 28467.1
  • GRAVY: -0.41627

Function[edit | edit source]

  • reaction:
    EC 3.5.99.6?  ExPASy
    Glucosamine-6-phosphate deaminase Alpha-D-glucosamine 6-phosphate + H2O = D-fructose 6-phosphate + NH3
  • TIGRFAM:
    Metabolism Central intermediary metabolism Amino sugars glucosamine-6-phosphate deaminase (TIGR00502; EC 3.5.99.6; HMM-score: 245.9)
    and 2 more
    Metabolism Energy metabolism Pentose phosphate pathway 6-phosphogluconolactonase (TIGR01198; EC 3.1.1.31; HMM-score: 64.9)
    Metabolism Energy metabolism Pentose phosphate pathway ribose 5-phosphate isomerase A (TIGR00021; EC 5.3.1.6; HMM-score: 11.8)
  • TheSEED:
  • PFAM:
    ISOCOT_Fold (CL0246) Glucosamine_iso; Glucosamine-6-phosphate isomerases/6-phosphogluconolactonase (PF01182; HMM-score: 71.9)
    and 1 more
    Sugar-bind; Putative sugar-binding domain (PF04198; HMM-score: 17.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.019992
    • TAT(Tat/SPI): 0.000322
    • LIPO(Sec/SPII): 0.008769
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446789159 NCBI
  • RefSeq: WP_000866415 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKVLNLGSKKQASFYVACELYKEMAFNQHCKLGLATGGTMTDLYEQLVKLLNKNQLNVDNVSTFNLDEYVGLTASHPQSYHYYMDDMLFKQYPYFNRKNIHIPNGDADDMNAEASKYNDVLEQQGQRDIQILGIGENGHIGFNEPGTPFDSVTHIVDLTESTIKANSRYFKNEDDVPKQAISMGLANILQAKRIILLAFGEKKRAAITHLLNQEISVDVPATLLHKHPNVEIYLDDEACPKNVAKIHVDEMD

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]