From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03285 [old locus tag: SACOL0636 ]
  • pan locus tag?: SAUPAN002371000
  • symbol: SACOL_RS03285
  • pan gene symbol?: mvaK1
  • synonym:
  • product: mevalonate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS03285 [old locus tag: SACOL0636 ]
  • symbol: SACOL_RS03285
  • product: mevalonate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 668159..669079
  • length: 921
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (668159..669079) NCBI
  • BioCyc: G1G4B-682 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGACAAGAAAAGGATATGGGGAATCGACAGGTAAGATTATTTTAATAGGAGAACATGCT
    GTTACATTTGGAGAGCCTGCTATTGCAGTACCGTTTAACGCAGGTAAAATCAAAGTTTTA
    ATAGAAGCCTTAGAGAGCGGGAACTATTCGTCTATTAAAAGCGATGTTTACGATGGTATG
    TTATATGATGCGCCTGACCATCTTAAGTCTTTGGTGAACCGTTTTGTAGAATTAAATAAT
    ATTACAGAGCCGCTAGCAGTAACGATCCAAACGAATTTACCACCATCACGTGGATTAGGA
    TCGAGTGCAGCTGTCGCGGTTGCTTTTGTTCGTGCAAGTTATGATTTTTTAGGGAAATCA
    TTAACGAAAGAAGAACTCATTGAAAAGGCTAATTGGGCAGAGCAAATTGCACATGGTAAA
    CCAAGTGGTATTGATACGCAAACGATTGTATCAGGCAAACCAGTTTGGTTCCAAAAAGGT
    CATGCTGAAACGTTGAAAACGTTAAGTTTAGACGGCTATATGGTTGTTATAGATACTGGT
    GTGAAAGGTTCAACAAGACAAGCAGTAGAAGATGTTCATAAACTTTGTGAGGACCCTCAG
    TACATGTCACATGTAAAACATATCGGTAAGTTAGTTTTACGTGCGAGTGATGTGATTGAA
    CATCATAACTTTGAAGCCTTAGCGGATATTTTTAATGAATGTCATGCGGATTTAAAGGCG
    TTGACAGTTAGTCATGATAAAATAGAACAATTAATGAAAATTGGTAAAGAAAATGGTGCG
    ATTGCTGGAAAACTTACTGGCGCTGGTCGTGGTGGAAGTATGTTATTGCTTGCCAAAGAT
    TTACCAACAGCGAAAAATATTGTAAAAGCTGTAGAAAAAGCTGGTGCAGCACATACTTGG
    ATTGAGAATTTAGGAGGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    921

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS03285 [old locus tag: SACOL0636 ]
  • symbol: SACOL_RS03285
  • description: mevalonate kinase
  • length: 306
  • theoretical pI: 6.96804
  • theoretical MW: 32918.5
  • GRAVY: -0.0977124

Function[edit | edit source]

  • reaction:
    EC 2.7.1.36?  ExPASy
    Mevalonate kinase ATP + (R)-mevalonate = ADP + (R)-5-phosphomevalonate
  • TIGRFAM:
    Metabolism Central intermediary metabolism Other mevalonate kinase (TIGR00549; EC 2.7.1.36; HMM-score: 290.8)
    and 6 more
    Metabolism Amino acid biosynthesis Aspartate family homoserine kinase (TIGR00191; EC 2.7.1.39; HMM-score: 46.8)
    Metabolism Energy metabolism Sugars galactokinase (TIGR00131; EC 2.7.1.6; HMM-score: 43.9)
    Metabolism Amino acid biosynthesis Aromatic amino acid family shikimate kinase (TIGR01920; EC 2.7.1.71; HMM-score: 36.2)
    Metabolism Central intermediary metabolism Other phosphomevalonate kinase (TIGR01220; EC 2.7.4.2; HMM-score: 25.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase (TIGR00154; EC 2.7.1.148; HMM-score: 20.3)
    Metabolism Central intermediary metabolism Other diphosphomevalonate decarboxylase (TIGR01240; EC 4.1.1.33; HMM-score: 14.3)
  • TheSEED:
  • PFAM:
    S5 (CL0329) GHMP_kinases_N; GHMP kinases N terminal domain (PF00288; HMM-score: 55.9)
    no clan defined GHMP_kinases_C; GHMP kinases C terminal (PF08544; HMM-score: 45.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.028291
    • TAT(Tat/SPI): 0.00151
    • LIPO(Sec/SPII): 0.002549
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446119179 NCBI
  • RefSeq: WP_000197034 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTRKGYGESTGKIILIGEHAVTFGEPAIAVPFNAGKIKVLIEALESGNYSSIKSDVYDGMLYDAPDHLKSLVNRFVELNNITEPLAVTIQTNLPPSRGLGSSAAVAVAFVRASYDFLGKSLTKEELIEKANWAEQIAHGKPSGIDTQTIVSGKPVWFQKGHAETLKTLSLDGYMVVIDTGVKGSTRQAVEDVHKLCEDPQYMSHVKHIGKLVLRASDVIEHHNFEALADIFNECHADLKALTVSHDKIEQLMKIGKENGAIAGKLTGAGRGGSMLLLAKDLPTAKNIVKAVEKAGAAHTWIENLGG

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]