From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS03965 [old locus tag: SACOL0772 ]
  • pan locus tag?: SAUPAN002598000
  • symbol: SACOL_RS03965
  • pan gene symbol?: queC
  • synonym:
  • product: 7-cyano-7-deazaguanine synthase QueC

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS03965 [old locus tag: SACOL0772 ]
  • symbol: SACOL_RS03965
  • product: 7-cyano-7-deazaguanine synthase QueC
  • replicon: chromosome
  • strand: -
  • coordinates: 792803..793471
  • length: 669
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (792803..793471) NCBI
  • BioCyc: G1G4B-821 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTGTATTAAATAATGAAAAAGCCATCGTTGTCTTTAGTGGTGGTCAAGACAGT
    ACAACATGTCTCTTTTATGCAAAAAAACATTTCAAAGAAGTTGAACTCGTAACGTTTAAT
    TATGGCCAAAGACATGATACTGAAATTGAAGTCGCAAAACAAATTGCACAAGATCAAGGA
    ATGAAACATCACGTTTTAGATATGTCATTATTATCACAACTTACTCCAAACGCATTAACA
    CAACATGATATGGAAATTACTAATAATGAAGATGGTATACCTAATACATTTGTTCCAGCT
    AGAAATTTACTTTTCTTGTCGTTTGCAGGCGCTCTAGCTTATCAAATTGGGGCTAAGCAT
    ATTATTACAGGCGTATGTGAAACAGACTTTTCAGGCTACCCAGACTGTCGCGATAGTTTT
    ATAAAATCAATGAACGTAACATTAAGCCTAGCTATGGACAAAGATTTTGTCATTCATACT
    CCTTTAATGTGGTTAAACAAAGCAGAAACGTGGAAATTAAGTGATGAACTCGAAGTTTTA
    GATTATATTCGTACAAAAACATTAACATGCTATAACGGTATCATTGGGGATGGCTGTGGT
    GAATGTCCAGCTTGTCATTTACGTCAACGTGGACTAAATCAATATCTTGAAAGTAAAGGA
    GCGCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS03965 [old locus tag: SACOL0772 ]
  • symbol: SACOL_RS03965
  • description: 7-cyano-7-deazaguanine synthase QueC
  • length: 222
  • theoretical pI: 5.27733
  • theoretical MW: 24887.2
  • GRAVY: -0.186937

Function[edit | edit source]

  • reaction:
    EC 6.3.4.20?  ExPASy
    7-cyano-7-deazaguanine synthase 7-carboxy-7-carbaguanine + NH3 + ATP = 7-cyano-7-carbaguanine + ADP + phosphate + H2O
  • TIGRFAM:
    Unknown function General queuosine biosynthesis protein QueC (TIGR00364; HMM-score: 278.9)
    and 11 more
    Hypothetical proteins Conserved TIGR00268 family protein (TIGR00268; HMM-score: 26.1)
    Metabolism Amino acid biosynthesis Aspartate family asparagine synthase (glutamine-hydrolyzing) (TIGR01536; EC 6.3.5.4; HMM-score: 26)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA(Ile)-lysidine synthetase (TIGR02432; EC 6.3.4.-; HMM-score: 23.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine tRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides NAD+ synthetase (TIGR00552; EC 6.3.1.5; HMM-score: 20.7)
    Metabolism Amino acid biosynthesis Glutamate family argininosuccinate synthase (TIGR00032; EC 6.3.4.5; HMM-score: 17.2)
    MJ0570-related uncharacterized domain (TIGR00290; HMM-score: 14.7)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis GMP synthase (glutamine-hydrolyzing), C-terminal domain (TIGR00884; EC 6.3.5.2; HMM-score: 13.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, small subunit (TIGR02039; EC 2.7.7.4; HMM-score: 12.5)
  • TheSEED:
  • PFAM:
    HUP (CL0039) QueC; Queuosine biosynthesis protein QueC (PF06508; HMM-score: 291.9)
    and 8 more
    Asn_synthase; Asparagine synthase (PF00733; HMM-score: 24.8)
    ATP_bind_3; PP-loop family (PF01171; HMM-score: 21.7)
    NAD_synthase; NAD synthase (PF02540; HMM-score: 19)
    PAPS_reduct; Phosphoadenosine phosphosulfate reductase family (PF01507; HMM-score: 17.8)
    Arginosuc_synth; Arginosuccinate synthase (PF00764; HMM-score: 16.8)
    ThiI; Thiamine biosynthesis protein (ThiI) (PF02568; HMM-score: 15.3)
    Diphthami_syn_2; Diphthamide synthase (PF01902; HMM-score: 14.2)
    TIM_barrel (CL0036) AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 13.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005103
    • TAT(Tat/SPI): 0.000115
    • LIPO(Sec/SPII): 0.000828
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446368869 NCBI
  • RefSeq: WP_000446724 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MESVLNNEKAIVVFSGGQDSTTCLFYAKKHFKEVELVTFNYGQRHDTEIEVAKQIAQDQGMKHHVLDMSLLSQLTPNALTQHDMEITNNEDGIPNTFVPARNLLFLSFAGALAYQIGAKHIITGVCETDFSGYPDCRDSFIKSMNVTLSLAMDKDFVIHTPLMWLNKAETWKLSDELEVLDYIRTKTLTCYNGIIGDGCGECPACHLRQRGLNQYLESKGAL

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]