From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00721
  • pan locus tag?: SAUPAN002598000
  • symbol: SAOUHSC_00721
  • pan gene symbol?: queC
  • synonym:
  • product: 7-cyano-7-deazaguanine synthase QueC

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00721
  • symbol: SAOUHSC_00721
  • product: 7-cyano-7-deazaguanine synthase QueC
  • replicon: chromosome
  • strand: -
  • coordinates: 704266..704934
  • length: 669
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGGAAAGTGTATTAAATAATGAAAAAGCCATCGTTGTCTTTAGTGGTGGTCAAGACAGT
    ACAACATGTCTCTTTTATGCAAAAAAACATTTCAAAGAAGTTGAACTCGTAACGTTTAAT
    TATGGCCAAAGACATGATACTGAAATTGAAGTCGCAAAACAAATTGCACAAGATCAAGGA
    ATGAAACATCACGTTTTAGATATGTCATTATTATCACAACTTACTCCAAACGCATTAACA
    CAACATGATATGGAAATTACTAATAATGAAGATGGTATACCTAATACATTTGTTCCAGCT
    AGAAATTTACTTTTCTTGTCGTTTGCAGGCGCTCTAGCTTATCAAATTGGGGCTAAGCAT
    ATTATTACAGGCGTATGTGAAACAGACTTTTCAGGCTACCCAGACTGTCGCGATAGTTTT
    ATAAAATCAATGAACGTAACATTAAGCCTAGCTATGGACAAAGATTTTGTCATTCATACT
    CCTTTAATGTGGTTAAACAAAGCAGAAACGTGGAAATTAAGTGATGAACTCGAAGTTTTA
    GATTATATTCGTACAAAAACATTAACATGCTATAACGGTATCATTGGGGATGGCTGTGGT
    GAATGTCCAGCTTGTCATTTACGTCAACGTGGACTAAATCAATATCTTGAAAGTAAAGGA
    GCGCTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    669

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00721
  • symbol: SAOUHSC_00721
  • description: 7-cyano-7-deazaguanine synthase QueC
  • length: 222
  • theoretical pI: 5.27733
  • theoretical MW: 24887.2
  • GRAVY: -0.186937

Function[edit | edit source]

  • reaction:
    EC 6.3.4.20?  ExPASy
    7-cyano-7-deazaguanine synthase 7-carboxy-7-carbaguanine + NH3 + ATP = 7-cyano-7-carbaguanine + ADP + phosphate + H2O
  • TIGRFAM:
    Unknown function General queuosine biosynthesis protein QueC (TIGR00364; HMM-score: 278.9)
    and 11 more
    Hypothetical proteins Conserved TIGR00268 family protein (TIGR00268; HMM-score: 26.1)
    Metabolism Amino acid biosynthesis Aspartate family asparagine synthase (glutamine-hydrolyzing) (TIGR01536; EC 6.3.5.4; HMM-score: 26)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA(Ile)-lysidine synthetase (TIGR02432; EC 6.3.4.-; HMM-score: 23.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine tRNA sulfurtransferase ThiI (TIGR00342; EC 2.8.1.4; HMM-score: 21.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides NAD+ synthetase (TIGR00552; EC 6.3.1.5; HMM-score: 20.7)
    Metabolism Amino acid biosynthesis Glutamate family argininosuccinate synthase (TIGR00032; EC 6.3.4.5; HMM-score: 17.2)
    MJ0570-related uncharacterized domain (TIGR00290; HMM-score: 14.7)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis GMP synthase (glutamine-hydrolyzing), C-terminal domain (TIGR00884; EC 6.3.5.2; HMM-score: 13.4)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 12.6)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, small subunit (TIGR02039; EC 2.7.7.4; HMM-score: 12.5)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, Pigments Tetrapyrroles Cobalamin  Queuosine Biosynthesis QueC ATPase
    and 4 more
    Miscellaneous Miscellaneous - no subcategory EC 6.3.4.- Ligases that form carbon-nitrogen bonds  Queuosine Biosynthesis QueC ATPase
    RNA Metabolism RNA processing and modification Queuosine-Archaeosine Biosynthesis  Queuosine Biosynthesis QueC ATPase
    Queuosine exploration RZ  Queuosine Biosynthesis QueC ATPase
    Test Q  Queuosine Biosynthesis QueC ATPase
  • PFAM:
    HUP (CL0039) QueC; Queuosine biosynthesis protein QueC (PF06508; HMM-score: 291.9)
    and 8 more
    Asn_synthase; Asparagine synthase (PF00733; HMM-score: 24.8)
    ATP_bind_3; PP-loop family (PF01171; HMM-score: 21.7)
    NAD_synthase; NAD synthase (PF02540; HMM-score: 19)
    PAPS_reduct; Phosphoadenosine phosphosulfate reductase family (PF01507; HMM-score: 17.8)
    Arginosuc_synth; Arginosuccinate synthase (PF00764; HMM-score: 16.8)
    ThiI; Thiamine biosynthesis protein (ThiI) (PF02568; HMM-score: 15.3)
    Diphthami_syn_2; Diphthamide synthase (PF01902; HMM-score: 14.2)
    TIM_barrel (CL0036) AP_endonuc_2; Xylose isomerase-like TIM barrel (PF01261; HMM-score: 13.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005103
    • TAT(Tat/SPI): 0.000115
    • LIPO(Sec/SPII): 0.000828
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MESVLNNEKAIVVFSGGQDSTTCLFYAKKHFKEVELVTFNYGQRHDTEIEVAKQIAQDQGMKHHVLDMSLLSQLTPNALTQHDMEITNNEDGIPNTFVPARNLLFLSFAGALAYQIGAKHIITGVCETDFSGYPDCRDSFIKSMNVTLSLAMDKDFVIHTPLMWLNKAETWKLSDELEVLDYIRTKTLTCYNGIIGDGCGECPACHLRQRGLNQYLESKGAL

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: PreQ1 riboswitch (transcription termination) regulon
    PreQ1 riboswitch(5' cis-acting region)important in Queuosine biosynthesis; compare RegPrecise for N315  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]