From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS04415 [old locus tag: SACOL0860 ]
  • pan locus tag?: SAUPAN002800000
  • symbol: SACOL_RS04415
  • pan gene symbol?: nuc
  • synonym:
  • product: thermonuclease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS04415 [old locus tag: SACOL0860 ]
  • symbol: SACOL_RS04415
  • product: thermonuclease
  • replicon: chromosome
  • strand: +
  • coordinates: 887710..888396
  • length: 687
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (887710..888396) NCBI
  • BioCyc: G1G4B-934 BioCyc
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACAGAATACTTATTAAGTGCTGGCATATGTATGGCAATCGTTTCAATATTACTTATA
    GGGATGGCTATCAGTAATGTTTCGAAAGGGCAATACGCAAAGAGGTTTTTCTATTTCGCT
    ACTAGTTGTTTAGTGTTAACTTTAGTTGTAGTTTCAAGTCTAAGTAGCTCAGCAAATGCA
    TCACAAACAGATAATGGCGTAAATAGAAGTGGTTCTGAAGATCCAACAGTATATAGTGCA
    ACTTCAACTAAAAAATTACATAAAGAACCTGCGACATTAATTAAAGCGATTGATGGTGAT
    ACGGTTAAATTAATGTACAAAGGTCAACCAATGACATTCAGACTATTATTGGTTGATACA
    CCTGAAACAAAGCATCCTAAAAAAGGTGTAGAGAAATATGGTCCTGAAGCAAGTGCATTT
    ACGAAAAAAATGGTAGAAAATGCAAAGAAAATTGAAGTCGAGTTTGACAAAGGTCAAAGA
    ACTGATAAATATGGACGTGGCTTAGCGTATATTTATGCTGATGGAAAAATGGTAAACGAA
    GCTTTAGTTCGTCAAGGCTTGGCTAAAGTTGCTTATGTTTATAAACCTAACAATACACAT
    GAACAACTTTTAAGAAAAAGTGAAGCACAAGCAAAAAAAGAGAAATTAAATATTTGGAGC
    GAAGACAACGCTGATTCAGGTCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit source | edit]

Protein Data Bank: 4WRD
Protein Data Bank: 5DAU

General[edit source | edit]

  • locus tag: SACOL_RS04415 [old locus tag: SACOL0860 ]
  • symbol: SACOL_RS04415
  • description: thermonuclease
  • length: 228
  • theoretical pI: 9.72183
  • theoretical MW: 25119.7
  • GRAVY: -0.34386

Function[edit source | edit]

  • reaction:
    EC 3.1.31.1?  ExPASy
    Micrococcal nucleaseEndonucleolytic cleavage to nucleoside 3'-phosphates and 3'-phosphooligonucleotide end-products
  • TIGRFAM:
    MetabolismTransport and binding proteinsNucleosides, purines and pyrimidinesnucleoside Transporter (TIGR00939; HMM-score: 12.9)
    Signal transductionRegulatory functionsProtein interactionsPhr family secreted Rap phosphatase inhibitor (TIGR04429; HMM-score: 11.6)
  • TheSEED:
  • PFAM:
    Tudor (CL0049) SNase; Staphylococcal nuclease homologue (PF00565; HMM-score: 122.9)
    and 2 more
    MFS (CL0015) Nucleoside_tran; Nucleoside transporter (PF01733; HMM-score: 13.1)
    no clan definedDUF1516; Protein of unknown function (DUF1516) (PF07457; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Ca2+
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 10
    • Internal Helices: 2
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 60 aa
    • SP(Sec/SPI): 0.459588
    • TAT(Tat/SPI): 0.030054
    • LIPO(Sec/SPII): 0.092442
    • Cleavage Site: CS pos: 60-61. ANA-SQ. Pr: 0.3797
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 486198857 NCBI
  • RefSeq: WP_001548082 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTEYLLSAGICMAIVSILLIGMAISNVSKGQYAKRFFYFATSCLVLTLVVVSSLSSSANASQTDNGVNRSGSEDPTVYSATSTKKLHKEPATLIKAIDGDTVKLMYKGQPMTFRLLLVDTPETKHPKKGVEKYGPEASAFTKKMVENAKKIEVEFDKGQRTDKYGRGLAYIYADGKMVNEALVRQGLAKVAYVYKPNNTHEQLLRKSEAQAKKEKLNIWSEDNADSGQ

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]