From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS05925 [old locus tag: SACOL1160 ]
  • pan locus tag?: SAUPAN003389000
  • symbol: SACOL_RS05925
  • pan gene symbol?: sdhB
  • synonym:
  • product: succinate dehydrogenase iron-sulfur subunit

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS05925 [old locus tag: SACOL1160 ]
  • symbol: SACOL_RS05925
  • product: succinate dehydrogenase iron-sulfur subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1170763..1171578
  • length: 816
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1170763..1171578) NCBI
  • BioCyc: G1G4B-1254 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGACTGAACAATCAGTGAAAAACACTCCACAACATGAAACACAATCTAAACCGAAACAA
    AAAACAGTAAAATTAATTATTAAACGACAAGATACAAGTGATTCTAAGCCTTATGAAGAA
    ACATTTGAAATTCCATATCGTGAAAATTTAAACGTCATTGCTTGTTTAATGGAAATTAGA
    CGTAACCCAGTTAATATTAAAGGTGAAAAAACAACACCTGTTGTCTGGGATATGAACTGC
    TTAGAAGAAGTATGTGGAGCATGTTCTATGGTTATCAATGGTCGTGCAAGACAATCTTGT
    TCTGCGATTGTTGATCAATTAGAACAACCTATTCGTTTAGAGCCAATGAATACTTTCCCA
    GTTATCCGTGACTTACAAGTTGATCGTTCTAGAATGTTCGATAACTTAAAACGTATGAAA
    GCATGGATCCCAATTGATGGAACGTATGATTTAGGTCCGGGACCACGTATGCCAGAGAAA
    AAACGTCAAACAGCTTATGAATTATCTAAATGTATGACATGTGGTGTATGTTTAGAGGTT
    TGTCCTAATGTTACTGAAAATAATAAATTCGTTGGTGCACAAGCAATCTCGCAAGTTCGT
    TTGTTTAATTTGCACCCAACAGGATCTATGACTAAAGATGAACGTTTAAATGCATTAATG
    GGTACTGGTGGCTTACAGCAGTGTGGTAATTCACAAAACTGTGTTAATGCTTGCCCTAAA
    GGTATTCCATTAACAACATCCATTGCAGCAATGAACAGAGAAACAACATTCCACATGTTT
    AAATCATTCTTTGGTTCAGACCATGAAGTAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    816

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS05925 [old locus tag: SACOL1160 ]
  • symbol: SACOL_RS05925
  • description: succinate dehydrogenase iron-sulfur subunit
  • length: 271
  • theoretical pI: 7.99685
  • theoretical MW: 30583.1
  • GRAVY: -0.501845

Function[edit | edit source]

  • reaction:
    EC 1.3.99.1?  ExPASy
    Deleted entry
  • TIGRFAM:
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    Metabolism Energy metabolism Anaerobic succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    Metabolism Energy metabolism Aerobic succinate dehydrogenase and fumarate reductase iron-sulfur protein (TIGR00384; HMM-score: 137.1)
    and 25 more
    Metabolism Energy metabolism Electron transport NADH-quinone oxidoreductase, chain I (TIGR01971; HMM-score: 19)
    Unknown function General archaeoflavoprotein, MJ0208 family (TIGR02700; HMM-score: 18.7)
    cytochrome c oxidase accessory protein CcoG (TIGR02745; HMM-score: 18)
    CoB--CoM heterodisulfide reductase, subunit C (TIGR03290; EC 1.8.98.1; HMM-score: 15.4)
    4-hydroxybenzoyl-CoA reductase, gamma subunit (TIGR03193; EC 1.3.7.9; HMM-score: 15.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Other selenium-dependent xanthine dehydrogenase (TIGR03311; EC 1.17.1.4; HMM-score: 15.1)
    pyruvate:ferredoxin (flavodoxin) oxidoreductase (TIGR02176; EC 1.2.7.1; HMM-score: 14.1)
    Metabolism Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 13.8)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, C subunit (TIGR03379; EC 1.1.5.3; HMM-score: 13.5)
    2-oxoacid:acceptor oxidoreductase, delta subunit, pyruvate/2-ketoisovalerate family (TIGR02179; HMM-score: 13.2)
    Metabolism Energy metabolism Electron transport NADH-plastoquinone oxidoreductase, I subunit (TIGR00403; EC 1.6.5.3; HMM-score: 13.1)
    Metabolism Energy metabolism Electron transport iron-sulfur cluster-binding protein (TIGR00273; HMM-score: 12)
    Metabolism Energy metabolism Methanogenesis putative methanogenesis marker 16 metalloprotein (TIGR03287; HMM-score: 11.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification epoxyqueuosine reductase (TIGR00276; EC 1.-.-.-; HMM-score: 11.8)
    Metabolism Energy metabolism Electron transport cytochrome c nitrite reductase, Fe-S protein (TIGR03149; EC 1.7.2.2; HMM-score: 11.5)
    Metabolism Energy metabolism Electron transport ferredoxin-type protein NapF (TIGR00402; HMM-score: 10.3)
    [FeFe] hydrogenase, group A (TIGR02512; EC 1.12.-.-; HMM-score: 9.9)
    Metabolism Energy metabolism Chemoautotrophy CO dehydrogenase/acetyl-CoA synthase complex, epsilon subunit (TIGR00314; EC 1.2.99.2; HMM-score: 9.4)
    methylamine methyltransferase corrinoid protein reductive activase (TIGR04270; HMM-score: 9.4)
    Metabolism Central intermediary metabolism Nitrogen fixation ferredoxin III, nif-specific (TIGR02936; HMM-score: 8.2)
    Metabolism Energy metabolism Electron transport electron transport complex, RnfABCDGE type, C subunit (TIGR01945; HMM-score: 7.7)
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 6.8)
    Genetic information processing Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 6.6)
    ferredoxin-type protein, NapH/MauN family (TIGR02163; HMM-score: 6.5)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfite reductase, dissimilatory-type beta subunit (TIGR02066; EC 1.8.99.3; HMM-score: 5.3)
  • TheSEED:
  • PFAM:
    Fer2 (CL0486) Fer2_3; 2Fe-2S iron-sulfur cluster binding domain (PF13085; HMM-score: 97.9)
    and 15 more
    4Fe-4S (CL0344) Fer4_8; 4Fe-4S dicluster domain (PF13183; HMM-score: 35.6)
    Fer4_7; 4Fe-4S dicluster domain (PF12838; HMM-score: 33.9)
    Fer4_9; 4Fe-4S dicluster domain (PF13187; HMM-score: 30.5)
    Fer4_10; 4Fe-4S dicluster domain (PF13237; HMM-score: 28.2)
    Fer4_17; 4Fe-4S dicluster domain (PF13534; HMM-score: 25.6)
    Fer4_16; 4Fe-4S double cluster binding domain (PF13484; HMM-score: 19.5)
    Fer4_2; 4Fe-4S binding domain (PF12797; HMM-score: 19.3)
    Fer4; 4Fe-4S binding domain (PF00037; HMM-score: 17.8)
    Fer4_15; 4Fe-4S single cluster domain (PF13459; HMM-score: 17.2)
    Fer4_13; 4Fe-4S single cluster domain of Ferredoxin I (PF13370; HMM-score: 16.8)
    Fer4_21; 4Fe-4S dicluster domain (PF14697; HMM-score: 14.7)
    Fer4_6; 4Fe-4S binding domain (PF12837; HMM-score: 13.8)
    Fer4_4; 4Fe-4S binding domain (PF12800; HMM-score: 12.9)
    Fer4_18; 4Fe-4S dicluster domain (PF13746; HMM-score: 11.5)
    Fer4_3; 4Fe-4S binding domain (PF12798; HMM-score: 9.8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.89
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004685
    • TAT(Tat/SPI): 0.00098
    • LIPO(Sec/SPII): 0.000969
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446061857 NCBI
  • RefSeq: WP_000139712 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTEQSVKNTPQHETQSKPKQKTVKLIIKRQDTSDSKPYEETFEIPYRENLNVIACLMEIRRNPVNIKGEKTTPVVWDMNCLEEVCGACSMVINGRARQSCSAIVDQLEQPIRLEPMNTFPVIRDLQVDRSRMFDNLKRMKAWIPIDGTYDLGPGPRMPEKKRQTAYELSKCMTCGVCLEVCPNVTENNKFVGAQAISQVRLFNLHPTGSMTKDERLNALMGTGGLQQCGNSQNCVNACPKGIPLTTSIAAMNRETTFHMFKSFFGSDHEVE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]