From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS07610 [old locus tag: SACOL1494 ]
  • pan locus tag?: SAUPAN003914000
  • symbol: asnC
  • pan gene symbol?: asnC
  • synonym:
  • product: asparagine--tRNA ligase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS07610 [old locus tag: SACOL1494 ]
  • symbol: asnC
  • product: asparagine--tRNA ligase
  • replicon: chromosome
  • strand: -
  • coordinates: 1532975..1534267
  • length: 1293
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1532975..1534267) NCBI
  • BioCyc: G1G4B-1604 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGAAAACAACGATTAAACAAGCGAAAGATCATTTAAACCAAGACGTTACAATTGGTGCT
    TGGTTAACAAATAAACGTTCAAGTGGTAAAATCGCCTTTTTACAATTACGTGATGGAACA
    GGCTTTATGCAAGGCGTAGTAGTTAAATCAGAAGTTGATGAAGAGGTATTCAAACTTGCG
    AAAGAAATTACTCAAGAATCATCTCTATACGTTACAGGCACAATTACAGAAGATAATCGT
    TCTGACTTAGGATACGAAATGCAAGTGAAATCAATTGAAGTTATTTCAGAAGCGCATGAC
    TATCCGATTACACCTAAAAATCATGGTACAGAATTCTTAATGGATCACCGTCATTTATGG
    TTACGTTCTAAAAAACAACATGCTGTAATGAAAATTAGAAATGAAGTTATTCGTGCAACG
    TATGAATTTTTCAACAAAGATGGATTTACAAAGGTTGATCCACCAATTTTGACAGCAAGT
    GCGCCAGAAGGTACAAGTGAATTATTCCATACTAAATACTTTGATCAAGATGCGTTTTTA
    TCTCAAAGTGGTCAGTTATACTTAGAAGCTGCAGCAATGGCACACGGAAAAGTATTTTCA
    TTTGGTCCAACTTTCAGAGCTGAAAAATCAAAAACACGTAGACACTTGATCGAGTTCTGG
    ATGATTGAAGGAGAAATGGCTTTCACAAATCATGCTGAAAGTTTAGAAATTCAAGAACAA
    TATGTAACACATGTTGTAAAATCAGTTTTAGAAAATTGTAAACTAGAGTTGAAAATTTTA
    GAGCGTGATACATCAAAACTTGAAAAAGTTGCGACACCATTCCCTAGAATTTCATATGAT
    GATGCAATTGAATTCTTAAAAGCAGAAGGCTTTGATGATATTGAATGGGGCGAAGATTTT
    GGTGCGCCACATGAAACAGCCATTGCTAATCATTATGATTTACCGGTGTTTATTACTAAT
    TATCCAACTAAAATTAAGCCTTTCTATATGCAACCAAATCCTGAAAATGAAGAAACTGTA
    TTATGTGCAGACTTAATTGCACCTGAAGGATACGGTGAAATTATTGGTGGATCTGAACGT
    GTGGATGACTTAGAATTGTTAGAACAACGCGTTAAAGAACATGGATTAGACGAAGAAGCA
    TATAGTTACTACTTAGACTTACGTCGTTATGGTAGTGTGCCACACTGTGGATTTGGTTTA
    GGTTTAGAGCGTACAGTAGCATGGATTTCTGGTGTTGAACACGTTCGTGAAACAGCGCCA
    TTCCCAAGATTATTAAACCGTTTATATCCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1293

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS07610 [old locus tag: SACOL1494 ]
  • symbol: AsnC
  • description: asparagine--tRNA ligase
  • length: 430
  • theoretical pI: 5.09478
  • theoretical MW: 49157.2
  • GRAVY: -0.443023

Function[edit | edit source]

  • reaction:
    EC 6.1.1.22?  ExPASy
    Asparagine--tRNA ligase ATP + L-asparagine + tRNA(Asn) = AMP + diphosphate + L-asparaginyl-tRNA(Asn)
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA aminoacylation asparagine--tRNA ligase (TIGR00457; EC 6.1.1.22; HMM-score: 546.9)
    and 6 more
    Genetic information processing Protein synthesis tRNA aminoacylation aspartate--tRNA(Asn) ligase (TIGR00458; EC 6.1.1.23; HMM-score: 336.8)
    Genetic information processing Protein synthesis tRNA aminoacylation aspartate--tRNA ligase (TIGR00459; EC 6.1.1.-; HMM-score: 156.2)
    Genetic information processing Protein synthesis tRNA aminoacylation lysine--tRNA ligase (TIGR00499; EC 6.1.1.6; HMM-score: 97.8)
    Unknown function General EF-P lysine aminoacylase GenX (TIGR00462; HMM-score: 34.4)
    Genetic information processing Protein synthesis tRNA aminoacylation pyrrolysine--tRNA ligase, C-terminal region (TIGR02367; EC 6.1.1.26; HMM-score: 22.1)
    Metabolism Energy metabolism Aerobic pyruvate oxidase (TIGR02720; EC 1.2.3.3; HMM-score: 11.3)
  • TheSEED:
  • PFAM:
    tRNA_synt_II (CL0040) tRNA-synt_2; tRNA synthetases class II (D, K and N) (PF00152; HMM-score: 278.6)
    and 5 more
    OB (CL0021) tRNA_anti-codon; OB-fold nucleic acid binding domain (PF01336; HMM-score: 59.7)
    tRNA_synt_II (CL0040) tRNA-synt_2b; tRNA synthetase class II core domain (G, H, P, S and T) (PF00587; HMM-score: 17.9)
    tRNA-synt_2d; tRNA synthetases class II core domain (F) (PF01409; HMM-score: 15.8)
    no clan defined YliH; Biofilm formation protein (YliH/bssR) (PF10799; HMM-score: 13.1)
    OB (CL0021) tRNA_anti_2; OB-fold nucleic acid binding domain (PF13742; HMM-score: 12.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SACOL_RS08930pyruvate kinase  [1] (data from MRSA252)
    SACOL_RS11435Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SACOL_RS1173530S ribosomal protein S17  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004447
    • TAT(Tat/SPI): 0.000467
    • LIPO(Sec/SPII): 0.000662
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446781533 NCBI
  • RefSeq: WP_000858789 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKTTIKQAKDHLNQDVTIGAWLTNKRSSGKIAFLQLRDGTGFMQGVVVKSEVDEEVFKLAKEITQESSLYVTGTITEDNRSDLGYEMQVKSIEVISEAHDYPITPKNHGTEFLMDHRHLWLRSKKQHAVMKIRNEVIRATYEFFNKDGFTKVDPPILTASAPEGTSELFHTKYFDQDAFLSQSGQLYLEAAAMAHGKVFSFGPTFRAEKSKTRRHLIEFWMIEGEMAFTNHAESLEIQEQYVTHVVKSVLENCKLELKILERDTSKLEKVATPFPRISYDDAIEFLKAEGFDDIEWGEDFGAPHETAIANHYDLPVFITNYPTKIKPFYMQPNPENEETVLCADLIAPEGYGEIIGGSERVDDLELLEQRVKEHGLDEEAYSYYLDLRRYGSVPHCGFGLGLERTVAWISGVEHVRETAPFPRLLNRLYP

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 1.2 1.3 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]