From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS09470 [old locus tag: SACOL1846 ]
  • pan locus tag?: SAUPAN004514000
  • symbol: SACOL_RS09470
  • pan gene symbol?:
  • synonym:
  • product: calcium-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS09470 [old locus tag: SACOL1846 ]
  • symbol: SACOL_RS09470
  • product: calcium-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1900664..1901314
  • length: 651
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1900664..1901314) NCBI
  • BioCyc: G1G4B-1984 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGAAAATAACATATAAATATAGAGGAGATTTACCTTTGAATACAGAGAACAACAAGAAT
    CAAAACCAATCTGTTAAAAATTCTGAAAGACGCGGCATGTTAAAAGGATGCGGCGGTTGC
    CTTATTTCTTTTATTTTATTAATAATCTTATTATCAGCCTGTTCAATGATGTTTAGTAAT
    AATGACAATTCCACTAATAATCAATCATCAAAAACGCAATTAACTCAAAAAGATGAAAAT
    AAAAATGAAGATAAGCCTGAGGAAAAATCAGAAACAGCAACAGATGAGGATTTACAATCA
    ACCGAAGAAGTACCTGCAAATGAAAATACTGAAAATAATCAACATGAAATTGATGAAATA
    ACAACAAAAGATCAATCAGACGATGATATTAACACACCAAACGTTGCAGAAGATAAATCA
    CAAGACGACTTGAAAGATGATTTAAAAGAAAAGCAACAATCAAGTAACCATCATCAATCC
    ACGCAACCTAAGACCTCACCATCAACTGAAACAAACACGCAACAATCATTTGCTAATTGT
    AAGCAACTTAGACAAGTATATCCGAATGGTGTCACTGCCGATCATCCAGCATATCGACCA
    CATTTAGATAGAGATAAAGATAAACGTGCATGTGAACCTGATAAATATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    651

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS09470 [old locus tag: SACOL1846 ]
  • symbol: SACOL_RS09470
  • description: calcium-binding protein
  • length: 216
  • theoretical pI: 4.66027
  • theoretical MW: 24543.5
  • GRAVY: -1.3963

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Pathogenesis putative immunoglobulin-blocking virulence protein (TIGR04526; HMM-score: 16.2)
    Cellular processes Cellular processes Pathogenesis type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion protein, HrcV family (TIGR01399; HMM-score: 14.6)
    TIGR03943 family protein (TIGR03943; HMM-score: 13.2)
    Cellular processes Cellular processes Cell division cell division protein FtsL (TIGR02209; HMM-score: 13)
    and 5 more
    Cellular processes Cellular processes Cell division cell division protein ZipA (TIGR02205; HMM-score: 10.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds potassium uptake protein, Trk family (TIGR00934; HMM-score: 5.8)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines nucleoside Transporter (TIGR00939; HMM-score: 5.6)
    Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AF (TIGR02896; HMM-score: 5.4)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 4.7)
  • TheSEED:
  • PFAM:
    no clan defined Excalibur; Excalibur calcium-binding domain (PF05901; HMM-score: 46.5)
    and 20 more
    TMEM51; Transmembrane protein 51 (PF15345; HMM-score: 16.1)
    Piezo_RRas_bdg; Piezo non-specific cation channel, R-Ras-binding domain (PF12166; HMM-score: 16)
    FAM176; FAM176 family (PF14851; HMM-score: 15.7)
    CRA; Circumsporozoite-related antigen (CRA) (PF06589; HMM-score: 15.6)
    DUF1510; Protein of unknown function (DUF1510) (PF07423; HMM-score: 11.6)
    DUF4775; Domain of unknown function (DUF4775) (PF16001; HMM-score: 11.3)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 9.9)
    O-anti_assembly (CL0499) O-antigen_lig; O-antigen ligase like membrane protein (PF13425; HMM-score: 9.5)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 9.1)
    AhpD-like (CL0423) PA26; PA26 p53-induced protein (sestrin) (PF04636; HMM-score: 8.9)
    no clan defined DUF4692; Domain of unknown function (DUF4692) (PF15763; HMM-score: 8.9)
    EphA2_TM; Ephrin type-A receptor 2 transmembrane domain (PF14575; HMM-score: 8.3)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 8.2)
    no clan defined SLC12; Solute carrier family 12 (PF03522; HMM-score: 7.9)
    SAPS; SIT4 phosphatase-associated protein (PF04499; HMM-score: 7.9)
    SARAF; SOCE-associated regulatory factor of calcium homoeostasis (PF06682; HMM-score: 7.6)
    P-loop_NTPase (CL0023) Hydin_ADK; Hydin Adenylate kinase-like domain (PF17213; HMM-score: 7.2)
    no clan defined G0-G1_switch_2; G0/G1 switch protein 2 (PF15103; HMM-score: 6.8)
    Golgi_traff (CL0456) Hid1; High-temperature-induced dauer-formation protein (PF12722; HMM-score: 6.1)
    no clan defined Macoilin; Macoilin family (PF09726; HMM-score: 5.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP:
  • SignalP: Signal peptide LIPO(Sec/SPII) length 53 aa
    • SP(Sec/SPI): 0.043276
    • TAT(Tat/SPI): 0.0134
    • LIPO(Sec/SPII): 0.689809
    • Cleavage Site: CS pos: 53-54. LSA-CS. Pr: 0.6043
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_001795535 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKITYKYRGDLPLNTENNKNQNQSVKNSERRGMLKGCGGCLISFILLIILLSACSMMFSNNDNSTNNQSSKTQLTQKDENKNEDKPEEKSETATDEDLQSTEEVPANENTENNQHEIDEITTKDQSDDDINTPNVAEDKSQDDLKDDLKEKQQSSNHHQSTQPKTSPSTETNTQQSFANCKQLRQVYPNGVTADHPAYRPHLDRDKDKRACEPDKY

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]