From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS10240 [old locus tag: SACOL1958 ]
  • pan locus tag?: SAUPAN004922000
  • symbol: SACOL_RS10240
  • pan gene symbol?: dgkB
  • synonym:
  • product: diacylglycerol kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS10240 [old locus tag: SACOL1958 ]
  • symbol: SACOL_RS10240
  • product: diacylglycerol kinase
  • replicon: chromosome
  • strand: -
  • coordinates: 2018568..2019515
  • length: 948
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (2018568..2019515) NCBI
  • BioCyc: G1G4B-2150 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAGGAAACGTGCTAGAATCATTTATAACCCGACATCAGGTAAAGAGCTATTTAAAAGA
    GAATTACCTGATGCCTTAATAAAATTAGAAAAAGCGGGATATGAAACGAGTGCATATGCA
    ACCGAGAAAATAGGTGATGCCACACTTGAAGCAGAAAGAGCTATGCATGAAAATTATGAT
    GTATTAATCGCTGCAGGTGGTGATGGAACATTAAATGAAGTAGTTAATGGTATCGCAGAA
    AAGCCTAATCGTCCTAAGCTAGGTGTCATTCCTATGGGTACTGTTAATGACTTTGGACGT
    GCATTGCATATACCTAATGACATCATGGGGGCACTTGATGTCATCATTGAAGGTCATTCT
    ACTAAAGTAGATATTGGTAAAATGAATAATCGATACTTTATTAATTTAGCTGCAGGCGGA
    CAATTGACGCAAGTCTCTTATGAAACACCGAGTAAATTGAAATCTATTGTTGGTCCATTT
    GCTTATTACATCAAAGGTTTCGAAATGTTACCTCAAATGAAAGCTGTAGATTTAAGAATT
    GAATATGATGGTAATGTTTTCCAAGGAGAAGCATTATTATTCTTTTTAGGTTTAACAAAT
    TCAATGGCAGGATTTGAAAAATTAGTGCCGGACGCTAAGTTAGATGACGGCTATTTTACG
    TTAATTATAGTTGAAAAATCAAACCTTGCAGAACTTGGTCATATTATGACTTTAGCTTCA
    AGAGGAGAACATACTAAGCATCCTAAAGTTATTTATGAAAAAGCAAAGGCAATTAATATT
    TCATCATTCACAGACTTACAACTAAATGTAGATGGAGAATATGGTGGTAAATTACCAGCG
    AATTTCTTAAATCTAGAACGTCATATAGATGTCTTTGCACCTAATGATATTGTAAATGAA
    GAGTTAATAAATAATGATCATGTTGATGACAATTTAATCGAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    948

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS10240 [old locus tag: SACOL1958 ]
  • symbol: SACOL_RS10240
  • description: diacylglycerol kinase
  • length: 315
  • theoretical pI: 4.92012
  • theoretical MW: 34886.6
  • GRAVY: -0.214921

Function[edit | edit source]

  • reaction:
    EC 2.7.1.107?  ExPASy
    Diacylglycerol kinase (ATP) ATP + 1,2-diacyl-sn-glycerol = ADP + 1,2-diacyl-sn-glycerol 3-phosphate
  • TIGRFAM:
    Unknown function Enzymes of unknown specificity lipid kinase, YegS/Rv2252/BmrU family (TIGR00147; EC 2.7.1.-; HMM-score: 307.9)
    and 1 more
    Unknown function Enzymes of unknown specificity lipid kinase YegS (TIGR03702; EC 2.7.1.-; HMM-score: 171.9)
  • TheSEED:
  • PFAM:
    PFK (CL0240) DAGK_cat; Diacylglycerol kinase catalytic domain (PF00781; HMM-score: 117)
    and 1 more
    NAD_kinase; ATP-NAD kinase (PF01513; HMM-score: 21.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009172
    • TAT(Tat/SPI): 0.0006
    • LIPO(Sec/SPII): 0.000736
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 447154195 NCBI
  • RefSeq: WP_001231451 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MRKRARIIYNPTSGKELFKRELPDALIKLEKAGYETSAYATEKIGDATLEAERAMHENYDVLIAAGGDGTLNEVVNGIAEKPNRPKLGVIPMGTVNDFGRALHIPNDIMGALDVIIEGHSTKVDIGKMNNRYFINLAAGGQLTQVSYETPSKLKSIVGPFAYYIKGFEMLPQMKAVDLRIEYDGNVFQGEALLFFLGLTNSMAGFEKLVPDAKLDDGYFTLIIVEKSNLAELGHIMTLASRGEHTKHPKVIYEKAKAINISSFTDLQLNVDGEYGGKLPANFLNLERHIDVFAPNDIVNEELINNDHVDDNLIEE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]