From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS13655 [old locus tag: SACOL2610 ]
  • pan locus tag?: SAUPAN006275000
  • symbol: SACOL_RS13655
  • pan gene symbol?:
  • synonym:
  • product: TetR/AcrR family transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS13655 [old locus tag: SACOL2610 ]
  • symbol: SACOL_RS13655
  • product: TetR/AcrR family transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2667835..2668422
  • length: 588
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (2667835..2668422) NCBI
  • BioCyc: G1G4B-2857 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGACTATAGATCGACGTATTAGAAAATCACAAGTTGCAATGAGAAATGCATTTATTGAA
    CTTTTACATCAACACCAATTAGAAGAGATTACTGTGCAACAAATTGCAGATTTAGCTGAT
    GTTAACCGTAGTACATTTTATACGCATTATTATGATAAGTATGATTTGCTTGAAAAATTA
    GAGGACCAGCAGTTGGAGGAAATAAGAGACTTCATTCATGATGAGAAGTTAAATGGAGCA
    GTTAAGTTATCCACGGATAACATACATCAAATTATGACCGTTTTAATAGAAATGATAGAA
    AAAGACATCGCATTTTATCAATTGATGTTTCGTATGGGTAAAGATTCAAATATCCACGAA
    AAACTTTATGATTTAATTATGTGTCATTTACAACGTTATAAAAATGAAAATGATCAAATT
    AATGGTATACCATTTTCTTATTTCATGAGTTATGTTTCAGGTGCGGGATTGTCTTTTATA
    AGACATTGGGTAGAAGATCCAAACCGTATAGACAAAGTTGACTTAATAAGGCATTTTAAT
    ACGATTGTCAATCAAGGGCCAGCAACGATAATTAAAAATATACAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    588

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS13655 [old locus tag: SACOL2610 ]
  • symbol: SACOL_RS13655
  • description: TetR/AcrR family transcriptional regulator
  • length: 195
  • theoretical pI: 6.02724
  • theoretical MW: 23193.4
  • GRAVY: -0.404103

Function[edit | edit source]

  • TIGRFAM:
    probable dihydroxyacetone kinase regulator (TIGR02366; HMM-score: 42.8)
    and 4 more
    Signal transduction Regulatory functions DNA interactions mycofactocin system transcriptional regulator (TIGR03968; HMM-score: 25.9)
    Signal transduction Regulatory functions DNA interactions transcriptional repressor BetI (TIGR03384; HMM-score: 21.1)
    sugar transferase, PEP-CTERM/EpsH1 system associated (TIGR03088; HMM-score: 15.6)
    pyrimidine utilization regulatory protein R (TIGR03613; HMM-score: 13.5)
  • TheSEED:
  • PFAM:
    no clan defined TetR_C_8; Transcriptional regulator C-terminal region (PF14278; HMM-score: 38.7)
    and 4 more
    HTH (CL0123) TetR_N; Bacterial regulatory proteins, tetR family (PF00440; HMM-score: 27.7)
    HTH_Tnp_1_2; Helix-turn-helix of insertion element transposase (PF13022; HMM-score: 16.8)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 14.7)
    no clan defined Tim17; Tim17/Tim22/Tim23/Pmp24 family (PF02466; HMM-score: 13.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001938
    • TAT(Tat/SPI): 0.000193
    • LIPO(Sec/SPII): 0.000249
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446073257 NCBI
  • RefSeq: WP_000151112 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTIDRRIRKSQVAMRNAFIELLHQHQLEEITVQQIADLADVNRSTFYTHYYDKYDLLEKLEDQQLEEIRDFIHDEKLNGAVKLSTDNIHQIMTVLIEMIEKDIAFYQLMFRMGKDSNIHEKLYDLIMCHLQRYKNENDQINGIPFSYFMSYVSGAGLSFIRHWVEDPNRIDKVDLIRHFNTIVNQGPATIIKNIQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]