Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_00167
- pan locus tag?: SAUPAN001056000
- symbol: SAOUHSC_00167
- pan gene symbol?: gisA
- synonym:
- product: peptide ABC transporter ATP-binding protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_00167
- symbol: SAOUHSC_00167
- product: peptide ABC transporter ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 180402..181994
- length: 1593
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919873 NCBI
- RefSeq: YP_498764 NCBI
- BioCyc: G1I0R-155 BioCyc
- MicrobesOnline: 1288658 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561ATGTCAAATTTATTAGAAGTCAACAGTCTGAATGTACAATTCAATTATGATGAAACTACA
GTTCAAGCGGTAAAAAACGTCTCTTTCGAATTACGAAAAAAACATATCCTAGGTATTGTT
GGTGAATCAGGATCAGGAAAAAGTATTACCGCTAAATCTATTTTAGGGCTACTACCAGAT
TATCCAGATCACACATTAACAGGAGAAATTATTTTTAATGGGCAATCGTTAAATAATTTA
TCAACTTCAGCGTTACAACAAATTCGAGGTAAGGATATTTCAATGATTTTTCAAGATCCA
CTCTCTTCGTTGAATCCAAGATTAACGATTGGCAAACAAATTACAGAAGTAATATTTCAA
CATAAACGTGTATCTAAATCTGAAGCAAAGTCGATGACAATAGACATTTTAGAAAAAGTA
GGTATAAAACATGCAACTCGACAATTTGATGCTTATCCACATGAACTTTCTGGTGGTATG
CGTCAACGTGTCATGATAGCAATGGCATTGATTTTAAAGCCACAAATTTTAATCGCAGAT
GAACCAACAACGGCATTAGATGCCAGTACACAAAATCAATTACTGCAGTTAATGAAGTCC
CTTTATGAGTACACAGAAACATCTATTATTTTTATCACTCACGATTTAGGCGCTGTGTAT
CAATTTTGCGACGATGTGATTGTAATGAAAGATGGAAGTGTCGTTGAAAGTGGCACGGTT
GAAAGTATTTTTAAATCGCCACAACATACCTATACAAAACGCTTAATAGATGCGATTCCT
GATATTCATCAAACGCGTCCGCCAAGACCGTTAAACAATGATATTTTATTAAAATTCGAT
CGCGTGAGCGTGGATTACACATCACCGAGTGGCAGCCTATACCGAGCAGTTAATGATATT
AACTTGGCTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGGAAA
TCGACATTAGCTAAGACGGTCGTCGGTCTAAAGGAAGTGTCAGAAGGCTTTATTTGGTAT
AACGAATTACCATTAAGTTTATTTAAAGATGATGAATTGAAATCTTTACGACAAGAGATA
CAAATGATTTTTCAAGATCCATTCGCATCTATTAATCCAAGATTTAAAGTCATTGATGTG
ATTAAACGACCACTAATCATTCATGGGAAAGTCAAAGATAATGATGACATTATTAAAACT
GTCGTATCGTTGTTAGAAAAGGTTGGCCTAGATCAAACTTTCTTATATCGCTATCCACAC
GAATTATCTGGTGGGCAACGTCAGCGTGTAAGTATCGCGAGAGCACTTGCTGTTGAACCT
AAAGTGATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATC
ATCGAGTTATTAAAACAATTACAGTTAGACTTCGGCATCACTTATTTATTCATCACACAT
GACATGGGTGTTATCAATGAAATATGTGATCGCGTTGCAGTTATGAAAAATGGCGAAATC
GTTGAACTGAATAACACAGAAGATATTATCAAACATCCGCAGTCAGACTATGCAAAGCAA
CTTATTTCAGAAGTAGCAGTTATTGCTAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1440
1500
1560
1593
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_00167
- symbol: SAOUHSC_00167
- description: peptide ABC transporter ATP-binding protein
- length: 530
- theoretical pI: 6.25442
- theoretical MW: 59175.8
- GRAVY: -0.08
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 447.4)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 410.8)and 79 moreD-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 332.1)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 325.7)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 323.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 305.3)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 290)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 289.6)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 278.5)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 276.4)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 274.8)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 271)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 267.2)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 261.2)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 259.2)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 245.5)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 230.8)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 230.1)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 226)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 214.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 212.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 212.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 211.6)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 207.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 192.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 191.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 184.2)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 181.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 180.7)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 179.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 179)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 178.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 177.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 173.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 169.9)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 165.8)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 161.6)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 159.3)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 153.9)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 142.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 138.9)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 135.6)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 132.4)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 110.5)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 96.2)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 85.1)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 80.8)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 77.9)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 68.3)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65.1)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 42)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 19.3)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 17.5)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15.2)Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 15.2)Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 13.8)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssC (TIGR03928; HMM-score: 11.8)Central intermediary metabolism Nitrogen fixation Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Regulatory functions DNA interactions Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 8.7)
- TheSEED :
- Putative glutathione transporter, ATP-binding component
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 223.1)and 48 moreSMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 53.1)AAA_22; AAA domain (PF13401; HMM-score: 41.6)no clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 40.2)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 34.8)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 29.3)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 26.5)NB-ARC; NB-ARC domain (PF00931; HMM-score: 26.1)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.7)ABC_ATPase; P-loop domain (PF09818; HMM-score: 23.4)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 22.8)AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.8)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 22.5)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 22.3)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 22)TniB; Bacterial TniB protein (PF05621; HMM-score: 21.6)AAA_33; AAA domain (PF13671; HMM-score: 20.9)NACHT; NACHT domain (PF05729; HMM-score: 20.2)AAA_23; AAA domain (PF13476; HMM-score: 19.3)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 18.9)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18.8)AAA_19; AAA domain (PF13245; HMM-score: 18.4)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.5)AAA_24; AAA domain (PF13479; HMM-score: 17.4)AAA_18; AAA domain (PF13238; HMM-score: 17.3)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 17)RNA_helicase; RNA helicase (PF00910; HMM-score: 16.6)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.2)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.8)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 15.7)Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 15.5)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 14.9)PhoH; PhoH-like protein (PF02562; HMM-score: 14.1)ATPase; KaiC (PF06745; HMM-score: 13.7)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.4)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 13.2)MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 12.6)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.3)T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 12)Cache (CL0165) dCache_2; Cache domain (PF08269; HMM-score: 11.6)P-loop_NTPase (CL0023) G-alpha; G-protein alpha subunit (PF00503; HMM-score: 11.4)AAA_13; AAA domain (PF13166; HMM-score: 11.4)no clan defined DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.6)P-loop_NTPase (CL0023) AAA_15; AAA ATPase domain (PF13175; HMM-score: 9.9)SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 9.8)AIG1; AIG1 family (PF04548; HMM-score: 9.5)AAA_10; AAA-like domain (PF12846; HMM-score: 9.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1213
- Cytoplasmic Membrane Score: 0.8609
- Cell wall & surface Score: 0.0007
- Extracellular Score: 0.0171
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006678
- TAT(Tat/SPI): 0.000447
- LIPO(Sec/SPII): 0.000277
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSNLLEVNSLNVQFNYDETTVQAVKNVSFELRKKHILGIVGESGSGKSITAKSILGLLPDYPDHTLTGEIIFNGQSLNNLSTSALQQIRGKDISMIFQDPLSSLNPRLTIGKQITEVIFQHKRVSKSEAKSMTIDILEKVGIKHATRQFDAYPHELSGGMRQRVMIAMALILKPQILIADEPTTALDASTQNQLLQLMKSLYEYTETSIIFITHDLGAVYQFCDDVIVMKDGSVVESGTVESIFKSPQHTYTKRLIDAIPDIHQTRPPRPLNNDILLKFDRVSVDYTSPSGSLYRAVNDINLAIRKGETLGIVGESGSGKSTLAKTVVGLKEVSEGFIWYNELPLSLFKDDELKSLRQEIQMIFQDPFASINPRFKVIDVIKRPLIIHGKVKDNDDIIKTVVSLLEKVGLDQTFLYRYPHELSGGQRQRVSIARALAVEPKVIVCDEAVSALDVSIQKDIIELLKQLQLDFGITYLFITHDMGVINEICDRVAVMKNGEIVELNNTEDIIKHPQSDYAKQLISEVAVIAK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell:
- interaction partners:
SAOUHSC_02494 (rpsE) 30S ribosomal protein S5 [3] (data from MRSA252) SAOUHSC_00530 elongation factor Tu [3] (data from MRSA252) SAOUHSC_01043 dihydrolipoamide dehydrogenase [3] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [4] : S54 < SAOUHSC_00167
⊟Regulation[edit | edit source]
- regulator: CymR* (repression) regulon
CymR* (TF) important in Cysteine metabolism; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [4]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 3.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ 4.0 4.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
