From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00217
  • pan locus tag?: SAUPAN001120000
  • symbol: SAOUHSC_00217
  • pan gene symbol?:
  • synonym:
  • product: sorbitol dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00217
  • symbol: SAOUHSC_00217
  • product: sorbitol dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 237129..238184
  • length: 1056
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    GTGAAAGCTTTAGTAAAAACAAGAGAAGGACATGGCAACTTAGAACTTCTTGATAAAGAA
    GTTGCAACACCGCTAGATGATAAAGTAAAGATTAAAGTACATTATGCAGGAATTTGTGGC
    ACAGATATTCATACTTATGAAGGTCATTATAAAGTTAATTTTCCAGTGACATTAGGTCAT
    GAATTTTCTGGTGAAATCGTTGAAGTTGGAGCAGACGTTAAAGATTTTAAAGTTGGTGAC
    CGTGTCACATCTGAAACGACATTCTATGTTTGTAATGAGTGTGAATACTGTAAATCAAAA
    GACTATAATTTATGCAACCATCGAAAAGGTATTGGAACACAAGTTGATGGCGCATTTACT
    AATTATGTCATTGCACGTGAAGAAAGTTTGCATCATATTCCAGACGAAGTATCGTATCAG
    TCTGCAGCTATGACAGAACCATTAGCATGTGCACATCATGGCGTTTCTAAGATTCAAGTC
    AATTCAGGCGATGTAGCAGTTGTAATGGGACCTGGGCCAATCGGATTACTTGTAGCACAA
    GTGTTAAAAAGTAAAGGCGCAACTGTTGTGGTAACTGGATTGGACAATGACAAAGTCAGA
    TTAGATAAAGCAGAAGCATTGCACATGGATTATGTAGTCAATTTACAACAAACAGACTTA
    AAAACGTATATCAATGGAATTACAGACGGTTACGGTGCAGATGTTGTTGTTGAATGTTCA
    GGTGCAGTTCCAGCAGCACGACAAGGTTTGGATATTTTACGCAAAAAAGGTTTCTACAGT
    CAAATAGGTATTTTTAAGGATGCTGAAATTCCATTTGATATGGAAAAAGTGATTCAAAAA
    GAAATAACAGTTGTTGGTAGTAGAAGTCAAAAGCCAGCAGATTGGGAACCTTCATTGCAA
    CTTATGGCGGATGGTTTAGTAAATGCTGAAGCTTTGGTGACAAAAATATATGATATTTCG
    AAATGGGACGAGGCGTATCAACATTTAAAATCCGGCGAAGGTATTAAAGCATTACTTAAG
    CCGCTCGATTTAGATGAAAATGAAGGAGAGAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1056

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00217
  • symbol: SAOUHSC_00217
  • description: sorbitol dehydrogenase
  • length: 351
  • theoretical pI: 5.05273
  • theoretical MW: 38456.4
  • GRAVY: -0.245014

Function[edit | edit source]

  • reaction:
    EC 1.1.1.14?  ExPASy
    L-iditol 2-dehydrogenase L-iditol + NAD+ = L-sorbose + NADH
  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines L-threonine 3-dehydrogenase (TIGR00692; EC 1.1.1.103; HMM-score: 220.8)
    and 18 more
    Unknown function Enzymes of unknown specificity NDMA-dependent alcohol dehydrogenase, Rxyl_3153 family (TIGR03989; EC 1.1.99.36; HMM-score: 118.6)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 111.8)
    Unknown function Enzymes of unknown specificity putative NAD(P)H quinone oxidoreductase, PIG3 family (TIGR02824; HMM-score: 106.3)
    6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase (TIGR03201; EC 1.1.1.-; HMM-score: 97.8)
    Metabolism Energy metabolism Fermentation zinc-binding alcohol dehydrogenase family protein (TIGR02822; EC 1.-.-.-; HMM-score: 94.4)
    Cellular processes Cellular processes Detoxification S-(hydroxymethyl)mycothiol dehydrogenase (TIGR03451; EC 1.1.1.306; HMM-score: 91.8)
    Cellular processes Cellular processes Detoxification S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 83.7)
    Metabolism Energy metabolism Fermentation S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase (TIGR02818; EC 1.1.1.1,1.1.1.284; HMM-score: 83.7)
    Metabolism Central intermediary metabolism One-carbon metabolism formaldehyde dehydrogenase, glutathione-independent (TIGR02819; EC 1.2.1.46; HMM-score: 74.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll chlorophyll synthesis pathway protein BchC (TIGR01202; HMM-score: 58.8)
    crotonyl-CoA carboxylase/reductase (TIGR01751; EC 1.3.1.85; HMM-score: 34.5)
    Unknown function Enzymes of unknown specificity putative quinone oxidoreductase, YhdH/YhfP family (TIGR02823; HMM-score: 29.4)
    Metabolism Energy metabolism Fermentation zinc-binding alcohol dehydrogenase family protein (TIGR02817; HMM-score: 15)
    Metabolism Energy metabolism Amino acids and amines adenosylhomocysteinase (TIGR00936; EC 3.3.1.1; HMM-score: 14)
    leukotriene B4 12-hydroxydehydrogenase/15-oxo-prostaglandin 13-reductase (TIGR02825; EC 1.3.1.48,1.3.1.74; HMM-score: 13)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 12.2)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 12.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin glutamyl-tRNA reductase (TIGR01035; EC 1.2.1.70; HMM-score: 10.5)
  • TheSEED:  
    Carbohydrates Monosaccharides D-Tagatose and Galactitol Utilization  Galactitol-1-phosphate 5-dehydrogenase (EC 1.1.1.251)
  • PFAM:
    GroES (CL0296) ADH_N; Alcohol dehydrogenase GroES-like domain (PF08240; HMM-score: 119.8)
    and 13 more
    NADP_Rossmann (CL0063) ADH_zinc_N; Zinc-binding dehydrogenase (PF00107; HMM-score: 92.9)
    Glu_dehyd_C; Glucose dehydrogenase C-terminus (PF16912; HMM-score: 57.5)
    ADH_zinc_N_2; Zinc-binding dehydrogenase (PF13602; HMM-score: 28.1)
    NAD_binding_3; Homoserine dehydrogenase, NAD binding domain (PF03447; HMM-score: 18.6)
    AdoHcyase_NAD; S-adenosyl-L-homocysteine hydrolase, NAD binding domain (PF00670; HMM-score: 17.8)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 16.4)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 13)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 12.4)
    Cache (CL0165) CHASE4; CHASE4 domain (PF05228; HMM-score: 12.2)
    NADP_Rossmann (CL0063) adh_short_C2; Enoyl-(Acyl carrier protein) reductase (PF13561; HMM-score: 12.2)
    GroES (CL0296) ADH_N_2; N-terminal domain of oxidoreductase (PF16884; HMM-score: 12.1)
    NADP_Rossmann (CL0063) 2-Hacid_dh_C; D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain (PF02826; HMM-score: 11.4)
    Hybrid (CL0105) HlyD; HlyD membrane-fusion protein of T1SS (PF00529; HMM-score: 11.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.018312
    • TAT(Tat/SPI): 0.000669
    • LIPO(Sec/SPII): 0.002456
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKALVKTREGHGNLELLDKEVATPLDDKVKIKVHYAGICGTDIHTYEGHYKVNFPVTLGHEFSGEIVEVGADVKDFKVGDRVTSETTFYVCNECEYCKSKDYNLCNHRKGIGTQVDGAFTNYVIAREESLHHIPDEVSYQSAAMTEPLACAHHGVSKIQVNSGDVAVVMGPGPIGLLVAQVLKSKGATVVVTGLDNDKVRLDKAEALHMDYVVNLQQTDLKTYINGITDGYGADVVVECSGAVPAARQGLDILRKKGFYSQIGIFKDAEIPFDMEKVIQKEITVVGSRSQKPADWEPSLQLMADGLVNAEALVTKIYDISKWDEAYQHLKSGEGIKALLKPLDLDENEGEN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]