From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01223
  • pan locus tag?: SAUPAN003549000
  • symbol: SAOUHSC_01223
  • pan gene symbol?: gid
  • synonym:
  • product: tRNA (uracil-5-)-methyltransferase Gid

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01223
  • symbol: SAOUHSC_01223
  • product: tRNA (uracil-5-)-methyltransferase Gid
  • replicon: chromosome
  • strand: +
  • coordinates: 1175049..1176356
  • length: 1308
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTCAAACTGTAAATGTAATAGGTGCTGGTCTTGCCGGTTCAGAAGCGGCATATCAA
    TTAGCTGAAAGAGGAATTAAAGTTAATCTAATAGAGATGAGACCTGTTAAACAAACACCA
    GCGCACCATACTGATAAATTTGCGGAACTTGTATGTTCCAATTCATTACGCGGAAATGCT
    TTAACTAATGGTGTGGGTGTTTTAAAAGAAGAAATGAGAAGATTGAATTCTATAATTATT
    GAAGCGGCTGATAAGGCACGAGTTCCAGCTGGTGGTGCATTAGCAGTTGATAGACACGAT
    TTTTCAGGTTATATTACTGAAACACTTAAAAATCATGAAAATATCACAGTTATTAATGAA
    GAAATTAATGCCATTCCAGATGGATACACAATTATCGCAACAGGACCACTTACTACAGAA
    ACCCTTGCGCAAGAAATAGTGGACATTACTGGTAAAGATCAACTTTATTTCTATGATGCG
    GCTGCTCCAATTATTGAAAAAGAATCTATTGATATGGATAAAGTTTACTTAAAGTCCCGT
    TATGATAAAGGTGAAGCTGCATATTTAAACTGTCCTATGACTGAGGATGAATTTAATCGC
    TTTTATGATGCAGTATTAGAAGCTGAAGTTGCGCCTGTAAATTCATTTGAAAAAGAAAAA
    TATTTCGAGGGTTGTATGCCTTTTGAAGTAATGGCAGAACGCGGACGCAAGACATTACTA
    TTTGGACCAATGAAACCAGTAGGATTAGAAGATCCAAAGACTGGGAAACGTCCTTATGCG
    GTGGTTCAATTAAGACAAGATGACGCTGCTGGTACACTCTACAATATTGTTGGCTTCCAA
    ACGCATTTAAAATGGGGAGCTCAAAAAGAAGTCATTAAATTAATTCCAGGCTTAGAAAAT
    GTTGATATTGTTAGATATGGTGTGATGCATAGAAATACCTTCATTAATTCACCGGACGTA
    TTAAACGAGAAATATGAATTGATTTCACAACCAAACATACAGTTTGCGGGACAAATGACT
    GGTGTTGAAGGTTATGTAGAAAGCGCAGCTAGCGGCTTAGTTGCAGGTATCAATCTTGCG
    CATAAAATATTAGGCAAGGGTGAGGTAGTATTTCCGAGAGAAACAATGATTGGAAGTATG
    GCTTACTATATTTCTCATGCTAAAAACAATAAGAATTTCCAACCTATGAATGCTAACTTC
    GGGTTATTACCATCTTTAGAAACTAGAATTAAAGATAAAAAAGAACGCTATGAAGCACAA
    GCTAATAGAGCTTTGGATTACTTAGAAAATTTCAAAAAAACTTTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1308

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01223
  • symbol: SAOUHSC_01223
  • description: tRNA (uracil-5-)-methyltransferase Gid
  • length: 435
  • theoretical pI: 5.53912
  • theoretical MW: 48370.9
  • GRAVY: -0.293793

Function[edit | edit source]

  • reaction:
    EC 2.1.1.74?  ExPASy
    Methylenetetrahydrofolate--tRNA-(uracil54-C5)-methyltransferase (FADH2-oxidizing) 5,10-methylenetetrahydrofolate + uracil54 in tRNA + FADH2 = tetrahydrofolate + 5-methyluracil54 in tRNA + FAD
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA:m(5)U-54 methyltransferase (TIGR00137; EC 2.1.1.74; HMM-score: 723.4)
    and 24 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 77.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 29.2)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 27.8)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 21.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 20.3)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, monomeric form (TIGR01377; HMM-score: 17.8)
    lycopene cyclase family protein (TIGR01790; HMM-score: 16.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 16.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 15.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 15)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 14.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 14.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 14.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 14.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 13.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 13.6)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 13.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 13)
    Metabolism Energy metabolism TCA cycle succinate dehydrogenase or fumarate reductase, flavoprotein subunit (TIGR01811; EC 1.3.99.1; HMM-score: 12.4)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 12.2)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 12.1)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 12)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 12)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 11.3)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  tRNA:m(5)U-54 MTase gid
    and 2 more
    Test - Folate  tRNA:m(5)U-54 MTase gid
    Conserved gene cluster associated with Met-tRNA formyltransferase  tRNA:m(5)U-54 MTase gid
  • PFAM:
    NADP_Rossmann (CL0063) GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 375.3)
    and 13 more
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 25.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 25.4)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 21.9)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 21.4)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 21.4)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 20.4)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 17.8)
    Thi4; Thi4 family (PF01946; HMM-score: 15)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 14.9)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 14.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 14)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 13.5)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 12.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    SAOUHSC_00005DNA gyrase subunit B  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.026118
    • TAT(Tat/SPI): 0.002886
    • LIPO(Sec/SPII): 0.005961
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTQTVNVIGAGLAGSEAAYQLAERGIKVNLIEMRPVKQTPAHHTDKFAELVCSNSLRGNALTNGVGVLKEEMRRLNSIIIEAADKARVPAGGALAVDRHDFSGYITETLKNHENITVINEEINAIPDGYTIIATGPLTTETLAQEIVDITGKDQLYFYDAAAPIIEKESIDMDKVYLKSRYDKGEAAYLNCPMTEDEFNRFYDAVLEAEVAPVNSFEKEKYFEGCMPFEVMAERGRKTLLFGPMKPVGLEDPKTGKRPYAVVQLRQDDAAGTLYNIVGFQTHLKWGAQKEVIKLIPGLENVDIVRYGVMHRNTFINSPDVLNEKYELISQPNIQFAGQMTGVEGYVESAASGLVAGINLAHKILGKGEVVFPRETMIGSMAYYISHAKNNKNFQPMNANFGLLPSLETRIKDKKERYEAQANRALDYLENFKKTL

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]