From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_02654
  • pan locus tag?: SAUPAN005890000
  • symbol: SAOUHSC_02654
  • pan gene symbol?: iruO
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_02654
  • symbol: SAOUHSC_02654
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2439887..2440921
  • length: 1035
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    ATGAAAGATGTTACAATCATTGGTGGCGGTCCGTCTGGTTTGTATGCAAGCTTTTATGCT
    GGATTGCGAGATATGTCTGTAAGATTGATAGATGTTCAATCTGAATTAGGGGGTAAGATG
    AGAATTTACCCTGAAAAAATTATTTGGGATATTGGCGGCATTGCGCCAAAACCTTGTCAT
    GAAATTTTAAAAGATACAATTAAGCAAGGATTATATTTTAAACCGGAAGTTCATTTGAAT
    GAACGTGTGGTAGATATTAGGAAAAAGGCAGAACGTCATTTCGAAGTTGAAACAGAAGCG
    GGAGAAATATATACATCGAAAGCAGTTATCATTGCAATTGGTGCGGGTATTATTAATCCA
    AAACAATTAGATGTTAAAGGTGTAGAGAGATATCAATTAACTAATTTACATTATGTTGTA
    CAAAGTTACAGACGTTTCAAAGATAAAGATGTATTAATATCAGGTGGAGGAAATACAGCA
    TTAGATTGGGCGCATGATATTGCCAAGATTGCTAAAAGCGTGACAGTTGTTTATCGAAAA
    GAAGATGTAAGTGGTCATGAAGCGATGAAAACGTTGGTGACAGATTTAAATGTGAAACTA
    TGCCCAAAAACACGTATTAAATACTTGGTCGGCAATGATGATGAAACGCATATAAGTGAA
    GTTGTTTTGGAACATGTTGAAAGTGGCGATAGGCATACAGTTAAATTTGACGATGTCATT
    ATTAGTCATGGGTTTGATCGTTGTAATACATTATTGAGTGAAACATCTTCAAAGCTAGAT
    ATGCATGATGATTGTCGTGTTAAAGGATTTGGTAATACGACAACTAGTATACCTGGTATC
    TATGCGTGTGGAGATATTGTTTATCATGATGCAAAATCACATCTAATTGCAAGTGCATTT
    AGTGATGGTGCAAATGCAGCGAACCTTGCTAAAACATATATCCAACCAGATGCGAATGCA
    GAGGGTTATGTTTCAAGTCATCATGAAGTGTTTAAAGAAGCGAATAAGACTATTGTAAAT
    AAACATTTATACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1035

Protein[edit | edit source]

Protein Data Bank: 5TWB
Protein Data Bank: 5TWC

General[edit | edit source]

  • locus tag: SAOUHSC_02654
  • symbol: SAOUHSC_02654
  • description: hypothetical protein
  • length: 344
  • theoretical pI: 6.95916
  • theoretical MW: 38229.3
  • GRAVY: -0.27936

Function[edit | edit source]

  • reaction:
    EC 1.18.1.2?  ExPASy
    Ferredoxin--NADP+ reductase 2 reduced ferredoxin + NADP+ + H+ = 2 oxidized ferredoxin + NADPH
  • TIGRFAM:
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 130)
    and 27 more
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 92.5)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 92.5)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 86.7)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 76.3)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 55.4)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 46.4)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 40.8)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 40.8)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 40.2)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 36.3)
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 35)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 34.5)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.4)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 30.9)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 30.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 28)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 27.7)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 27.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 24.5)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 23.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 23)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 19.5)
    lycopene cyclase family protein (TIGR01790; HMM-score: 18.2)
    flavin-dependent oxidoreductase, MSMEG_0569 family (TIGR04046; HMM-score: 17.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 14.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin protoporphyrinogen oxidase (TIGR00562; EC 1.3.3.4; HMM-score: 13.1)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 11.5)
  • TheSEED:  
    Nucleosides and Nucleotides Pyrimidines pyrimidine conversions  Thioredoxin reductase (EC 1.8.1.9)
    and 1 more
    Sulfur Metabolism Sulfur Metabolism - no subcategory Thioredoxin-disulfide reductase  Thioredoxin reductase (EC 1.8.1.9)
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 106.9)
    and 14 more
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 83.9)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 48)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 42.3)
    K_oxygenase; L-lysine 6-monooxygenase (NADPH-requiring) (PF13434; HMM-score: 30.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 27.5)
    Thi4; Thi4 family (PF01946; HMM-score: 24.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 21.9)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 21.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 21.5)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 21.2)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 20.7)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 19.3)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 16.7)
    FMO-like; Flavin-binding monooxygenase-like (PF00743; HMM-score: 15.2)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005715
    • TAT(Tat/SPI): 0.000504
    • LIPO(Sec/SPII): 0.001405
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKDVTIIGGGPSGLYASFYAGLRDMSVRLIDVQSELGGKMRIYPEKIIWDIGGIAPKPCHEILKDTIKQGLYFKPEVHLNERVVDIRKKAERHFEVETEAGEIYTSKAVIIAIGAGIINPKQLDVKGVERYQLTNLHYVVQSYRRFKDKDVLISGGGNTALDWAHDIAKIAKSVTVVYRKEDVSGHEAMKTLVTDLNVKLCPKTRIKYLVGNDDETHISEVVLEHVESGDRHTVKFDDVIISHGFDRCNTLLSETSSKLDMHDDCRVKGFGNTTTSIPGIYACGDIVYHDAKSHLIASAFSDGANAANLAKTYIQPDANAEGYVSSHHEVFKEANKTIVNKHLY

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]

Slade A Loutet, Marek J Kobylarz, Crystal H T Chau, Michael E P Murphy
IruO is a reductase for heme degradation by IsdI and IsdG proteins in Staphylococcus aureus.
J Biol Chem: 2013, 288(36);25749-59
[PubMed:23893407] [WorldCat.org] [DOI] (I p)