Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_03019
- pan locus tag?: SAUPAN006440000
- symbol: SAOUHSC_03019
- pan gene symbol?: —
- synonym:
- product: ABC transporter ATP-binding protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_03019
- symbol: SAOUHSC_03019
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: -
- coordinates: 2792018..2793730
- length: 1713
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3921286 NCBI
- RefSeq: YP_501468 NCBI
- BioCyc: G1I0R-2840 BioCyc
- MicrobesOnline: 1291439 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681ATGACTGAACCAATTATCTCGTTCAAAGACTTTAGTTTTCAATATCATAGTCAAGCAACA
CCTACATTACAGAATATAAATGTTGATATTTATCCAGGAGAAAAAGTATTAGTAGTTGGT
GCTTCGGGTAGTGGTAAATCGACTTTTGCAAATTGCATAAACGGATTAATTCCATTTAAA
ACTAAAGGTAACATAACTGGGGAACTATATATAAATAATCAAGATGCAACCGTTAGTTGT
TTACATGATAGATCTAATGTTGTTGGTACAGTTTTACAAGATACAGATGGACAGTTCATA
GGCTTAACAGCAGCTGAAGATATGGCCTTTTTATTAGAAAATAATTGTGTTGAACAAGAT
GATATGAAGAAAAATGTAAGTTATTGGGCTGAAAAAGTTGGCATGATAGAACATTTAAAT
CACCGACCGCAAGATTTATCTGGAGGTCAAAAACAACGCGTTTCATTAGGTGGTATATTA
ATCCATCGTACGCCTATTTTAATATTGGATGAGCCACTGGCCAATTTAGATCCTGCGACA
GGACATGAAACGCTGAGATTGTTAAACAATATTCATGAAGAAACAAAGTCAACGATGATT
ATTGTCGAACATCGATTAGAAGAATCATTAGATGATACGTTTGATAGAGTTCTTCTTTTT
AAAGATGGAAAAATCATCGCTAATACAACGCCTAGTGATTTGCTAAAATCATCTAAGCTT
AAAGAAGCAGGCATACGTGAACCATTATACTGTACAGCGCTTAAATATGCAGAAGTAGAT
GTCGAATCCATTGATAACTTAGCGAATTTACGTGACGTTTGTATGAGTGAACATGTTAAA
TTTAAAGTGAAAAAATGGATAGATGAAACATCTGCAAATAATGATAATAAGTACAAATCT
GAACCGCTATTAGAATTAAATGAGGTATGTGTTCAATATAGTGACTATAGTAATAGTGTA
CTTAATAATGTTCAATTAAATGTTTATAGAAAAGAAATGCTTAGTATAGTTGGTCACAAT
GGTGCCGGCAAATCAACACTTGCTAAAGCAATTTGTGGATTTTTAGATATAACAGGTAAT
ATCCAATTTTGTAATAGGGGATTTAATCAATTGTCAATTAGCGAACGATCTGAATTCGTA
GGTTATGTGATGCAAAATCCAAATCATATGATTTCTGAAAAAATGATTTACGATGAAGTA
GCATTAGGGTTAAGAGCACGAGGTATGAAAGAATCAGATATAAAGATACGAGTAGAGAAT
GTGCTCAAAATATGCGGACTTTATGCATTTCGGAATTGGCCAATTGCAGCTTTAAGCTAT
GGTCAAAAAAAGAGGGTCACTATAGCATCTGTTTTAGTCTTAAATCCGGAAATAATCATA
TTGGATGAACCGACTGCTGGTCAAGATTTCTATCATTATAATGAGATAATGTCATTTTTA
ATTGAACTAAACAGACAGGGGAAGACGATTATTATGATTACGCATGATATGCATTTATTG
TCTGAGTATAGTTCAAGAACAGTTGTATTATCAAAAGGTCAAGTCGTTGCTGATACCACG
CCAGTATTGGTTTTAAATGATAAAAAAATCTGTGAGATTGCATCATTGAGACAAACATCG
CTATTTGAAATGGCCGAATATATAGGGATTAGCGAGCCACAGAAATTAGTACAATTATTT
ATTAACCATGATAGGAAGGTGAGACGCCAATGA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1440
1500
1560
1620
1680
1713
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_03019
- symbol: SAOUHSC_03019
- description: ABC transporter ATP-binding protein
- length: 570
- theoretical pI: 6.01395
- theoretical MW: 64116
- GRAVY: -0.20614
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 387.8)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 338.9)and 87 moreCellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 248.4)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 246.7)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 228.4)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 228.4)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 215.9)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 212.1)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 208.1)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 207.3)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 202.4)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 202.4)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 199.1)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 198.8)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 196.4)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 196.2)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 195.1)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 191.7)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 188.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.1)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.1)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 186)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 181)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 180)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 178.5)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 177.2)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 177.1)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 175.7)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 174.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 172.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 172.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 172.2)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 171.8)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.3)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.3)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 170.3)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 166.3)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 159.4)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 159.4)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 159.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 158.1)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 158.1)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 156.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 152.9)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 152.7)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 148.9)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 148.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 148.6)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 142.9)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 142.9)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 142.3)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 141.9)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 137.5)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 137.5)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 134.5)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 130.5)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 129.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 127.5)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 126.7)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 115.8)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 114.2)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 111.2)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 111.2)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 106.7)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 102.9)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 94.7)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 76.5)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.2)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 62.7)P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 22.9)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 16.8)DNA metabolism DNA replication, recombination, and repair DNA replication and repair protein RecF (TIGR00611; HMM-score: 16.1)Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 15.9)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 15.9)Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 15)Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 14.1)DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 13.5)Cellular processes Conjugation P-type conjugative transfer ATPase TrbB (TIGR02782; HMM-score: 13.3)Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 13.2)DNA metabolism DNA replication, recombination, and repair phage/plasmid primase, P4 family, C-terminal domain (TIGR01613; HMM-score: 13)Mobile and extrachromosomal element functions Prophage functions phage/plasmid primase, P4 family, C-terminal domain (TIGR01613; HMM-score: 13)Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 12.8)KaiC domain protein, AF_0351 family (TIGR03880; HMM-score: 12.3)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 12)helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 12)Transcription RNA processing polynucleotide kinase-phosphatase (TIGR04075; HMM-score: 11.7)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 10.1)
- TheSEED :
- Duplicated ATPase component MtsB of energizing module of methionine-regulated ECF transporter
Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Methionine Biosynthesis Duplicated ATPase component MtsB of energizing module of methionine-regulated ECF transporterand 1 more - PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 193.7)and 52 moreno clan defined DUF3744; ATP-binding cassette cobalt transporter (PF12558; HMM-score: 74.4)P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 48.7)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 39.4)AAA_23; AAA domain (PF13476; HMM-score: 37.6)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 36.5)AAA_22; AAA domain (PF13401; HMM-score: 31.4)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 29.8)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 28.8)AAA_16; AAA ATPase domain (PF13191; HMM-score: 26.9)AAA_33; AAA domain (PF13671; HMM-score: 24)Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.7)Dynamin_N; Dynamin family (PF00350; HMM-score: 21.4)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.6)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 20.4)RNA_helicase; RNA helicase (PF00910; HMM-score: 20.1)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 20)Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 19.9)NACHT; NACHT domain (PF05729; HMM-score: 19)ABC_ATPase; P-loop domain (PF09818; HMM-score: 18.7)AAA_18; AAA domain (PF13238; HMM-score: 18.7)NB-ARC; NB-ARC domain (PF00931; HMM-score: 18.1)FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 18)DUF87; Helicase HerA, central domain (PF01935; HMM-score: 18)AAA_25; AAA domain (PF13481; HMM-score: 17.7)AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 17.4)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.3)AAA_24; AAA domain (PF13479; HMM-score: 16)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 15.8)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 15.8)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 15.7)AAA_27; AAA domain (PF13514; HMM-score: 15.6)ATPase; KaiC (PF06745; HMM-score: 15.4)G-alpha; G-protein alpha subunit (PF00503; HMM-score: 14.9)NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 14.7)AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 14.6)AAA_15; AAA ATPase domain (PF13175; HMM-score: 14.6)Septin; Septin (PF00735; HMM-score: 14.3)Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.1)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 13.7)AAA_14; AAA domain (PF13173; HMM-score: 13.7)ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.5)PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 13.1)APS_kinase; Adenylylsulphate kinase (PF01583; HMM-score: 13.1)AAA_13; AAA domain (PF13166; HMM-score: 13.1)NTPase_1; NTPase (PF03266; HMM-score: 12.5)DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 12.5)PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.2)AAA_19; AAA domain (PF13245; HMM-score: 12)Viral_helicase1; Viral (Superfamily 1) RNA helicase (PF01443; HMM-score: 11.7)AAA_28; AAA domain (PF13521; HMM-score: 11.3)AIG1; AIG1 family (PF04548; HMM-score: 10.9)Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 10)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.17
- Cytoplasmic Membrane Score: 9.51
- Cellwall Score: 0.16
- Extracellular Score: 0.15
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1246
- Cytoplasmic Membrane Score: 0.8709
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0045
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.059546
- TAT(Tat/SPI): 0.001419
- LIPO(Sec/SPII): 0.003022
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTEPIISFKDFSFQYHSQATPTLQNINVDIYPGEKVLVVGASGSGKSTFANCINGLIPFKTKGNITGELYINNQDATVSCLHDRSNVVGTVLQDTDGQFIGLTAAEDMAFLLENNCVEQDDMKKNVSYWAEKVGMIEHLNHRPQDLSGGQKQRVSLGGILIHRTPILILDEPLANLDPATGHETLRLLNNIHEETKSTMIIVEHRLEESLDDTFDRVLLFKDGKIIANTTPSDLLKSSKLKEAGIREPLYCTALKYAEVDVESIDNLANLRDVCMSEHVKFKVKKWIDETSANNDNKYKSEPLLELNEVCVQYSDYSNSVLNNVQLNVYRKEMLSIVGHNGAGKSTLAKAICGFLDITGNIQFCNRGFNQLSISERSEFVGYVMQNPNHMISEKMIYDEVALGLRARGMKESDIKIRVENVLKICGLYAFRNWPIAALSYGQKKRVTIASVLVLNPEIIILDEPTAGQDFYHYNEIMSFLIELNRQGKTIIMITHDMHLLSEYSSRTVVLSKGQVVADTTPVLVLNDKKICEIASLRQTSLFEMAEYIGISEPQKLVQLFINHDRKVRRQ
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [1] [2]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SAOUHSC_03018 < SAOUHSC_03019 < SAOUHSC_03020 < SAOUHSC_03021predicted SigA promoter [3] : SAOUHSC_03016 < S1180 < SAOUHSC_03017 < SAOUHSC_03018 < SAOUHSC_03019 < SAOUHSC_03020 < SAOUHSC_03021 < S1181
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [3]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 3.0 3.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
