From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_03053
  • pan locus tag?: SAUPAN006489000
  • symbol: trmE
  • pan gene symbol?: trmE
  • synonym:
  • product: tRNA modification GTPase TrmE

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_03053
  • symbol: trmE
  • product: tRNA modification GTPase TrmE
  • replicon: chromosome
  • strand: -
  • coordinates: 2819018..2820397
  • length: 1380
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGGATTTAGATACAATTACGAGTATTTCAACACCAATGGGTGAAGGGGCAATTGGAATT
    GTTCGATTGTCTGGACCGCAAGCCGTTGAAATTGCTGACAAATTATATAAAGGAAAACAT
    CTTTTAAATGATGTTCCATCACATACGATTAATTACGGTCATATTATTGATCCAGAGTCT
    AAAGAAGTGGTTGAAGAAGTTATGGTGTCTGTGTTAAGAGCGCCAAAAACATTTACACGC
    GAAGATATTATAGAAATTAATTGTCATGGTGGTATTTTAACGATTAATAGAGTGCTGGAA
    CTTACTATGACATATGGCGCTAGAATGGCTGAGCCAGGTGAATTTACAAAACGTGCCTTT
    TTAAATGGTCGTATTGATTTATCTCAAGCTGAAGCAGTTATGGACTTTATTCGCTCGAAG
    ACAGATAGAGCTTCTAAAGTTGCGATGAATCAAATTGAAGGTCGTCTAAGTGACTTAATC
    AAAAAACAACGTCAATCTATATTAGAGATACTCGCTCAAGTGGAAGTGAATATTGATTAT
    CCTGAATACGATGATGTTGAAGATGCGACTACTGAATTTCTTTTAGAGCAGTCTAAAGAA
    ATCAAACAGGAAATTAATCGTTTATTAGATACCGGTGCGCAGGGTAAAATTATGCGTGAA
    GGTTTATCTACAGTTATTGTTGGTAAACCAAACGTAGGTAAATCATCGATGTTAAATAAT
    TTAATACAAGATAATAAAGCGATTGTAACTGAGGTAGCAGGTACTACTAGAGATGTCTTA
    GAAGAGTACGTCAATGTTCGTGGCGTGCCATTAAGATTAGTTGATACTGCTGGTATACGT
    GAGACAGAAGATATAGTAGAGAAGATTGGTGTTGAACGCTCTAGAAAGGCTCTTAGCCAA
    GCAGACTTAATTTTATTTGTATTAAACAATAACGAAGCATTGACTCAAGAAGATTACACA
    TTATATGAAGTGGTTAAAAATGAAGATGTAATCGTAATTGTTAATAAAATGGATTTAGAG
    CAAAACATAGATATTAATGAAGTTAAAGATATGATAGGTGATACGCCATTAATTCAAACT
    TCAATGTTAAAACAAGAAGGTATTGATGAATTAGAAATACAAATTCGAGATTTGTTCTTT
    GGTGGAGAAGTACAAAATCAAGATATGACTTATGTTTCTAATTCAAGACATATTTCATTA
    TTAAAACAAGCAAGACAAACGATACAAGATGCGATTGATGCAGCAGAATCTGGTGTGCCT
    ATGGATATGGTACAAATTGATTTAACTAGAACTTGGGAAATATTAGGAGAAATTATTGGT
    GAGACTGCAAGTGATGAACTCATCGATCAGTTATTCAGTCAATTCTGCTTAGGTAAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_03053
  • symbol: TrmE
  • description: tRNA modification GTPase TrmE
  • length: 459
  • theoretical pI: 4.30301
  • theoretical MW: 51341.2
  • GRAVY: -0.20719

Function[edit | edit source]

  • reaction:
    EC 3.6.-.-?  ExPASy
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 434.7)
    and 13 more
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 115.9)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 91.5)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 90.6)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 67.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 53.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 48.9)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 38)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 25.9)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 22.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines chloroplast protein import component Toc86/159, G and M domains (TIGR00993; HMM-score: 20.7)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 19.2)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 14.3)
    Metabolism Transport and binding proteins Nucleosides, purines and pyrimidines GTP-binding protein (TIGR00991; HMM-score: 14.1)
  • TheSEED:  
    Clustering-based subsystems Cell Division Cell Division Subsystem including YidCD  GTPase and tRNA-U34 5-formylation enzyme TrmE
    and 1 more
    Protein Metabolism Protein biosynthesis Universal GTPases  GTPase and tRNA-U34 5-formylation enzyme TrmE
  • PFAM:
    no clan defined MnmE_helical; MnmE helical domain (PF12631; HMM-score: 195.8)
    and 14 more
    FBD (CL0289) TrmE_N; GTP-binding protein TrmE N-terminus (PF10396; HMM-score: 132.5)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 86.5)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 44.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 31.6)
    Ras; Ras family (PF00071; HMM-score: 30.5)
    AIG1; AIG1 family (PF04548; HMM-score: 29.5)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 27.4)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.9)
    Gtr1_RagA; Gtr1/RagA G protein conserved region (PF04670; HMM-score: 21.6)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 21.2)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 14.8)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.3)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 11.4)
    GHD (CL0369) Cyc-maltodext_C; Cyclo-malto-dextrinase C-terminal domain (PF10438; HMM-score: 10.9)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: K+
  • effectors:
  • protein partners:
    SAOUHSC_01232(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SAOUHSC_02494(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SAOUHSC_02441alkaline shock protein 23  [2] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009237
    • TAT(Tat/SPI): 0.000955
    • LIPO(Sec/SPII): 0.001934
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDLDTITSISTPMGEGAIGIVRLSGPQAVEIADKLYKGKHLLNDVPSHTINYGHIIDPESKEVVEEVMVSVLRAPKTFTREDIIEINCHGGILTINRVLELTMTYGARMAEPGEFTKRAFLNGRIDLSQAEAVMDFIRSKTDRASKVAMNQIEGRLSDLIKKQRQSILEILAQVEVNIDYPEYDDVEDATTEFLLEQSKEIKQEINRLLDTGAQGKIMREGLSTVIVGKPNVGKSSMLNNLIQDNKAIVTEVAGTTRDVLEEYVNVRGVPLRLVDTAGIRETEDIVEKIGVERSRKALSQADLILFVLNNNEALTQEDYTLYEVVKNEDVIVIVNKMDLEQNIDINEVKDMIGDTPLIQTSMLKQEGIDELEIQIRDLFFGGEVQNQDMTYVSNSRHISLLKQARQTIQDAIDAAESGVPMDMVQIDLTRTWEILGEIIGETASDELIDQLFSQFCLGK

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. 2.0 2.1 2.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  5. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]