From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1424 [new locus tag: SAUSA300_RS07770 ]
  • pan locus tag?: SAUPAN001438000
  • symbol: SAUSA300_1424
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1424 [new locus tag: SAUSA300_RS07770 ]
  • symbol: SAUSA300_1424
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 1583418..1583975
  • length: 558
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGAAAGCAAAAGTATTAAATAAAACTAAAGTGATTACAGGAAAAGTAAGAGCATCATAT
    GCACATATTTTTGAACCTCACAGTATGCAAGAAGGGCAAGAATCAAAGTATTCAATCAGT
    TTAATCATTCCTAAATCAGATACAAGTACGATAAAAGCCATTGAACAAGCTATAGAAGCT
    GCTAAAGAAGAAGGAAAAGTTAGTAAGTTTGGAGGCAAAGTTCCTGCAAATCTGAAACTT
    CCATTACGTGATGGAGATACTGAAAGAGAAGATGATGTCAATTATCAAGACGCTTATTTT
    ATTAACGCATCAAGCAAACAAGCACCTGGTATTATTGACCAAAACAAAATTAGATTAACG
    GATTCTGGAACTGTTGTAAGTGGTGATTATATTAGAGCTTCAATTAATCTATTTCCTTTC
    AACACAAATGGTAATAAGGGTATCGCAGTTGGATTGAACAACATTCAACTTGTAGAAAAA
    GGCGAACCTCTTGGCGGTGCAAGTGCAGCAGAAGATGATTTCGATGAATTAGACACTGAT
    GATGAGGATTTCTTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    558

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1424 [new locus tag: SAUSA300_RS07770 ]
  • symbol: SAUSA300_1424
  • description: hypothetical protein
  • length: 185
  • theoretical pI: 4.6081
  • theoretical MW: 20123.3
  • GRAVY: -0.500541

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 10)
    Signal transduction Signal transduction Two-component systems putative PEP-CTERM system histidine kinase (TIGR02916; EC 2.7.13.3; HMM-score: 10)
  • TheSEED:  
    Phage protein
  • PFAM:
    no clan defined DUF2815; Protein of unknown function (DUF2815) (PF10991; HMM-score: 232.5)
    and 1 more
    DUF320; Small secreted domain (DUF320) (PF03777; HMM-score: 12.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.78
    • Cytoplasmic Membrane Score: 8.16
    • Cellwall Score: 0.06
    • Extracellular Score: 0.01
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008561
    • TAT(Tat/SPI): 0.000309
    • LIPO(Sec/SPII): 0.001356
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKAKVLNKTKVITGKVRASYAHIFEPHSMQEGQESKYSISLIIPKSDTSTIKAIEQAIEAAKEEGKVSKFGGKVPANLKLPLRDGDTEREDDVNYQDAYFINASSKQAPGIIDQNKIRLTDSGTVVSGDYIRASINLFPFNTNGNKGIAVGLNNIQLVEKGEPLGGASAAEDDFDELDTDDEDFL

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]