From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1753 [new locus tag: SAUSA300_RS09595 ]
  • pan locus tag?: SAUPAN004558000
  • symbol: splF
  • pan gene symbol?: splF
  • synonym:
  • product: serine protease SplF

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1753 [new locus tag: SAUSA300_RS09595 ]
  • symbol: splF
  • product: serine protease SplF
  • replicon: chromosome
  • strand: -
  • coordinates: 1938755..1939474
  • length: 720
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGAATAAAAATATAATCATCAAAAGTATTGGAGCATTGACGATTTTAACATCAATAACT
    GGTGTCGGCACAACAATGGTTGAAGGTATTCAACAAACAGCCAAAGCCGAAAATACTGTT
    AAACAAATTACAAATACAAATGTTGCACCATACAGTGGTGTTACATGGATGGGCGCTGGA
    ACAGGATTTGTAGTTGGAAATCATACAATCATTACCAATAAACATGTTACCTATCACATG
    AAAGTCGGTGATGAAATCAAAGCACATCCTAATGGTTTTTATAATAACGGTGGTGGACTT
    TATAAAGTTACTAAGATTGTAGATTATCCTGGTAAAGAAGATATTGCGGTTGTACAAGTT
    GAAGAAAAATCAACACAACCAAAAGGTAGAAAATTCAAAGATTTCACTAGTAAATTTAAT
    ATAGCATCAGAAGCTAAAGAAAATGAACCTATATCAGTCATTGGTTATCCAAATCCTAAT
    GGAAATAAACTACAAATGTATGAATCAACTGGTAAAGTATTATCAGTGAATGGGAATATA
    GTGTCATCGGATGCAATTATTCAGCCTGGTAGCTCTGGTTCACCTATATTAAATAGTAAA
    CACGAAGCTATTGGTGTAATCTATGCCGGTAATAAGCCATCAGGTGAAAGCACAAGAGGA
    TTTGCTGTTTATTTCTCTCCTGAAATTAAGAAATTCATTGCAGATAATTTAGATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1753 [new locus tag: SAUSA300_RS09595 ]
  • symbol: SplF
  • description: serine protease SplF
  • length: 239
  • theoretical pI: 9.6769
  • theoretical MW: 25640.9
  • GRAVY: -0.300418

Function[edit | edit source]

  • reaction:
    EC 3.4.21.19?  ExPASy
    Glutamyl endopeptidase Preferential cleavage: Glu-|-Xaa, Asp-|-Xaa
  • TIGRFAM:
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 25)
    Genetic information processing Protein fate Protein folding and stabilization peptidase Do (TIGR02037; EC 3.4.21.-; HMM-score: 25)
  • TheSEED:  
    serine protease
  • PFAM:
    Peptidase_PA (CL0124) Trypsin_2; Trypsin-like peptidase domain (PF13365; HMM-score: 62.5)
    Trypsin; Trypsin (PF00089; HMM-score: 59)
    and 3 more
    Peptidase_S7; Peptidase S7, Flavivirus NS3 serine protease (PF00949; HMM-score: 24.2)
    Peptidase_S46; Peptidase S46 (PF10459; HMM-score: 17.1)
    Peptidase_S29; Hepatitis C virus NS3 protease (PF02907; HMM-score: 12.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.09
    • Cellwall Score: 0.18
    • Extracellular Score: 9.73
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: 1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide SP(Sec/SPI) length 36 aa
    • SP(Sec/SPI): 0.950235
    • TAT(Tat/SPI): 0.006885
    • LIPO(Sec/SPII): 0.012155
    • Cleavage Site: CS pos: 36-37. AKA-EN. Pr: 0.7986
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNKNIIIKSIGALTILTSITGVGTTMVEGIQQTAKAENTVKQITNTNVAPYSGVTWMGAGTGFVVGNHTIITNKHVTYHMKVGDEIKAHPNGFYNNGGGLYKVTKIVDYPGKEDIAVVQVEEKSTQPKGRKFKDFTSKFNIASEAKENEPISVIGYPNPNGNKLQMYESTGKVLSVNGNIVSSDAIIQPGSSGSPILNSKHEAIGVIYAGNKPSGESTRGFAVYFSPEIKKFIADNLDK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]