From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1884 [new locus tag: SAUSA300_RS10310 ]
  • pan locus tag?: SAUPAN004932000
  • symbol: SAUSA300_1884
  • pan gene symbol?:
  • synonym:
  • product: CamS sex pheromone cAM373

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1884 [new locus tag: SAUSA300_RS10310 ]
  • symbol: SAUSA300_1884
  • product: CamS sex pheromone cAM373
  • replicon: chromosome
  • strand: -
  • coordinates: 2046243..2047442
  • length: 1200
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGAAGCGTACATTAGTATTATTGATTACAGCTATCTTTATACTCGCTGCTTGTGGTAAC
    CATAAGGATGACCAGGCTGGAAAAGATAATCAAAAACATAACAATAGTTCAAATCAAGTA
    AAAGAAATTGCAACGGATAAAAATGTACAAGGTGATAACTATCGTACATTGTTACCATTT
    AAAGAAAGCCAGGCAAGAGGACTTTTACAAGATAACATGGCAAATAGTTATAATGGCGGC
    GACTTTGAAGATGGTTTATTGAACTTAAGTAAAGAAGTATTTCCAACAGATAAATATTTG
    TATCAAGATGGTCAATTTTTGGACAAGAAAACAATTAATGCCTATTTAAATCCTAAGTAT
    ACAAAACGTGAAATCGATAAAATGTCTGAAAAAGATAAAAAAGACAAGAAAGCGAATGAA
    AATTTAGGACTTAATCCATCACACGAAGGTGAAACAGATCCTGAAAAGATTGCAGAAAAA
    TCACCAGCCTATTTATCTAACATTTTAGAGCAAGATTTTTATGGTGGTGGAGATACAAAA
    GGTAAGAATATTAAAGGTATGACGATTGGTTTAGCTATGAATAGTGTTTATTACTATAAA
    AAAGAAAAAGATGGATCGACTTTTAGTAAAAAACTAGATGATAGCGAAGTTAAAAAGCAA
    GGTAAACAAATGGCTAGTGAGATATTATCAAGGTTACGTGAAAATGATGATTTAAAAGAT
    ATACCAATTCATTTTGCAATTTATAAGCAATCAAGTGAAGATTCAATCACACCAGGTGAA
    TTTATCACTCAAGCGACTGCAGAAAAGAGTCAAACAAAGCTTAATGAATGGCATAATATC
    AATGAAAAATCAGCTTTATTACCTTCTTCAACAGCAGCAGATTATGATGAAAATTTAAAT
    AATAATTTCAAGCAATTTAATGATAATTTGCAATCATATTTTTCTAATTTCACACAAGCA
    GTAGGGAAAGTTAAATTTGTTGATAAAAAGCCACAACGATTAGTAGTAGATTTACCAATC
    GATTACTATGGACAAGCTGAAACAATTGGTATTACACAGTACGTTACTGAACAAGCGAAT
    AAATATTTCGATAAAATCGATAACTATGAAATTCGTATTAAAGATGGTAACCAACCACGT
    GCTTTAATTAGTAAGACAAAAGATGACAAAGAACCGCAAGTTCATATTTACAGTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1884 [new locus tag: SAUSA300_RS10310 ]
  • symbol: SAUSA300_1884
  • description: CamS sex pheromone cAM373
  • length: 399
  • theoretical pI: 6.29166
  • theoretical MW: 45380.3
  • GRAVY: -0.927569

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Sporulation and germination sporulation lipoprotein, YhcN/YlaJ family (TIGR02898; HMM-score: 12.9)
  • TheSEED:  
    Regulation and Cell signaling Regulation and Cell signaling - no subcategory Sex pheromones in Enterococcus faecalis and other Firmicutes  Putative pheromone cAM373 precursor lipoprotein CamS
  • PFAM:
    no clan defined CamS; CamS sex pheromone cAM373 precursor (PF07537; HMM-score: 380.2)
    and 1 more
    Spore_YhcN_YlaJ; Sporulation lipoprotein YhcN/YlaJ (Spore_YhcN_YlaJ) (PF09580; HMM-score: 11.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 0
  • LocateP: Lipid anchored
    • Prediction by SwissProt Classification: Extracellular
    • Pathway Prediction: Sec-(SPII)
    • Intracellular possibility: 0
    • Signal peptide possibility: 0.5
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: ILAACGN
  • SignalP: Signal peptide LIPO(Sec/SPII) length 17 aa
    • SP(Sec/SPI): 0.000545
    • TAT(Tat/SPI): 0.000098
    • LIPO(Sec/SPII): 0.999003
    • Cleavage Site: CS pos: 17-18. LAA-CG. Pr: 0.9998
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MKRTLVLLITAIFILAACGNHKDDQAGKDNQKHNNSSNQVKEIATDKNVQGDNYRTLLPFKESQARGLLQDNMANSYNGGDFEDGLLNLSKEVFPTDKYLYQDGQFLDKKTINAYLNPKYTKREIDKMSEKDKKDKKANENLGLNPSHEGETDPEKIAEKSPAYLSNILEQDFYGGGDTKGKNIKGMTIGLAMNSVYYYKKEKDGSTFSKKLDDSEVKKQGKQMASEILSRLRENDDLKDIPIHFAIYKQSSEDSITPGEFITQATAEKSQTKLNEWHNINEKSALLPSSTAADYDENLNNNFKQFNDNLQSYFSNFTQAVGKVKFVDKKPQRLVVDLPIDYYGQAETIGITQYVTEQANKYFDKIDNYEIRIKDGNQPRALISKTKDDKEPQVHIYSN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]