From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2259 [new locus tag: SAUSA300_RS12480 ]
  • pan locus tag?: SAUPAN005788000
  • symbol: SAUSA300_2259
  • pan gene symbol?:
  • synonym:
  • product: putative transcriptional regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2259 [new locus tag: SAUSA300_RS12480 ]
  • symbol: SAUSA300_2259
  • product: putative transcriptional regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 2428549..2429472
  • length: 924
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAGCCTACCGAAAAAAATATTTTTATGGGTATTCGGTATTTTAGTAATCTTAGCGATT
    GTAGCTGTTGTGTATGTAGCTGCTAAAATTTTTATTACTGGTAATAAGATACACAATCCG
    TTAGATCGCAATCATTCAGAATTAAGAGATAAAAAAGTGAGTTTAAACGATGGTGATCCA
    TTCACAATCGCTTTATTTGGTGTCGATTCAGATGCTGATCGTAAGAAAAAGGGTGGCGGA
    GAGCGTAGTGATAGTATTATGATTTTATCTATCAACCCTAAAACGAAGAAAACTGAAATA
    GTAAGTATACCGCGTGATACAAGAGCGGAAATTGTTGGCCGTGGTACTACTGAAAAAATT
    GCACATGCCTATGCATATGGTGGACCAAATATGGCTGTTAAATCACTTGAAAAATTAATG
    AATGTGCCAATTGATCATTATGCGACAATCGATATGGATGGTTTGCATAATATGATAGAT
    AGCATCGGCGGTGTTGATGTAGTAAGTAATGATACATTCACTGTTGATGGTGTTCGTTTT
    ACAAAAGGACAGCAGACACATGTAAATGGTGATCAAGCATTGAAGTTTATTAGAAGTCGT
    AAAGAAGAAGGTGCTGGTGGTGACTTTGGTCGACAACAACGTCAGCAAATTGTGCTTGAA
    GCGATGGCCAATAAGATTGCAAGCCCATCATCGATTACACATTTTAATAGTCTAATGAAT
    GAAATTCAAAATAATGTTAAAACAGATTTAACATTAGGTGATTTGAATACGATTAGAAGC
    AATTATAAAGATGCTAATGACACGATTAATAAACATCAATTGAGTGGTCAAGGCGGCATT
    CAAAGTGACGGATTGTACTACTTCATTCCTAGTGAGCAGTCAAAAGCTGAAAGTACTAAG
    TTATTAAAAGATAATCTAGAGTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    924

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_2259 [new locus tag: SAUSA300_RS12480 ]
  • symbol: SAUSA300_2259
  • description: putative transcriptional regulator
  • length: 307
  • theoretical pI: 8.71513
  • theoretical MW: 33804.2
  • GRAVY: -0.359935

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions Other cell envelope-related function transcriptional attenuator common domain (TIGR00350; HMM-score: 149.4)
  • TheSEED:  
    Regulation and Cell signaling Regulation and Cell signaling - no subcategory Cell envelope-associated LytR-CpsA-Psr transcriptional attenuators  Cell envelope-associated transcriptional attenuator LytR-CpsA-Psr, subfamily F2 (as in PMID19099556)
  • PFAM:
    no clan defined LytR_cpsA_psr; Cell envelope-related transcriptional attenuator domain (PF03816; HMM-score: 166.9)
    and 1 more
    DUF3053; Protein of unknown function (DUF3053) (PF11254; HMM-score: 12.7)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.68
    • Cellwall Score: 0.17
    • Extracellular Score: 0.16
    • Internal Helix: 1
  • LocateP: N-terminally anchored (No CS)
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: 0.5
    • N-terminally Anchored Score: 7
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.180738
    • TAT(Tat/SPI): 0.002035
    • LIPO(Sec/SPII): 0.018103
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSLPKKIFLWVFGILVILAIVAVVYVAAKIFITGNKIHNPLDRNHSELRDKKVSLNDGDPFTIALFGVDSDADRKKKGGGERSDSIMILSINPKTKKTEIVSIPRDTRAEIVGRGTTEKIAHAYAYGGPNMAVKSLEKLMNVPIDHYATIDMDGLHNMIDSIGGVDVVSNDTFTVDGVRFTKGQQTHVNGDQALKFIRSRKEEGAGGDFGRQQRQQIVLEAMANKIASPSSITHFNSLMNEIQNNVKTDLTLGDLNTIRSNYKDANDTINKHQLSGQGGIQSDGLYYFIPSEQSKAESTKLLKDNLE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAUSA300_2259 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]