From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_2457 [new locus tag: SAUSA300_RS13630 ]
  • pan locus tag?: SAUPAN006162000
  • symbol: SAUSA300_2457
  • pan gene symbol?: mhqE
  • synonym:
  • product: phospholipase/carboxylesterase family protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_2457 [new locus tag: SAUSA300_RS13630 ]
  • symbol: SAUSA300_2457
  • product: phospholipase/carboxylesterase family protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2654776..2655369
  • length: 594
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    ATGGAACATATTTTTAGAGAAGGACAAAATGGTGCGCCAACACTAATATTATTGCATGGT
    ACAGGTGGTGATGAGTTCGATTTATTACCGTTAGGCGAAGCATTGAATGAAAATTATCAC
    TTGTTAAGTATTAGAGGACAAGTTTCAGAAAATGGGATGAACCGTTATTTCAAACGTCTT
    GGTGAAGGTGTTTATGATGAAGAAGATTTGGCATTTCGTGGACAAGAATTGTTGACGTTC
    ATTAAAGAAGCTGCTGAACGTTATGATTTTGATATTGAAAAAGCAGTACTTGTTGGATTT
    TCAAATGGATCAAATATAGCGATTAACTTAATGTTGCGTTCAGAAGCACCATTTAAAAAA
    GCATTGTTATATGCACCGTTATACCCAGTTGAAGTAACGTCAACAAAGGATTTATCAGAT
    GTCAGTGTGTTGCTTTCTATGGGGAAACATGATCCAATTGTGCCATTAGCTGCAAGTGAA
    CAAGTCATTAACTTGTTTAATACACGTGGGGCACAAGTCGAAGAAGTTTGGGTGAAGGGC
    CATGAAATTACAGAAACTGGATTAACGGCTGGTCAACAAATACTTGGGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    594

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_2457 [new locus tag: SAUSA300_RS13630 ]
  • symbol: SAUSA300_2457
  • description: phospholipase/carboxylesterase family protein
  • length: 197
  • theoretical pI: 4.54427
  • theoretical MW: 21792.6
  • GRAVY: -0.147208

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 21.8)
    pyrimidine utilization protein D (TIGR03611; HMM-score: 18.6)
    and 1 more
    Metabolism Energy metabolism Photosynthesis putative magnesium chelatase accessory protein (TIGR03056; HMM-score: 13.5)
  • TheSEED:  
    Carboxylesterase (EC 3.1.1.1)
  • PFAM:
    AB_hydrolase (CL0028) Abhydrolase_2; Phospholipase/Carboxylesterase (PF02230; HMM-score: 41.1)
    and 11 more
    Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 28)
    DLH; Dienelactone hydrolase family (PF01738; HMM-score: 21.5)
    Peptidase_S9; Prolyl oligopeptidase family (PF00326; HMM-score: 19.9)
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 18.9)
    Esterase; Putative esterase (PF00756; HMM-score: 18.2)
    Abhydrolase_3; alpha/beta hydrolase fold (PF07859; HMM-score: 18.1)
    DUF915; Alpha/beta hydrolase of unknown function (DUF915) (PF06028; HMM-score: 16.8)
    FSH1; Serine hydrolase (FSH1) (PF03959; HMM-score: 13.6)
    Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 13)
    Abhydrolase_4; TAP-like protein (PF08386; HMM-score: 11.7)
    DUF676; Putative serine esterase (DUF676) (PF05057; HMM-score: 11.2)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004416
    • TAT(Tat/SPI): 0.000376
    • LIPO(Sec/SPII): 0.001099
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MEHIFREGQNGAPTLILLHGTGGDEFDLLPLGEALNENYHLLSIRGQVSENGMNRYFKRLGEGVYDEEDLAFRGQELLTFIKEAAERYDFDIEKAVLVGFSNGSNIAINLMLRSEAPFKKALLYAPLYPVEVTSTKDLSDVSVLLSMGKHDPIVPLAASEQVINLFNTRGAQVEEVWVKGHEITETGLTAGQQILGK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]