From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS00040 [old locus tag: SAUSA300_0007 ]
  • pan locus tag?: SAUPAN000013000
  • symbol: SAUSA300_RS00040
  • pan gene symbol?: nnrD
  • synonym:
  • product: NAD(P)H-hydrate dehydratase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS00040 [old locus tag: SAUSA300_0007 ]
  • symbol: SAUSA300_RS00040
  • product: NAD(P)H-hydrate dehydratase
  • replicon: chromosome
  • strand: -
  • coordinates: 9782..10594
  • length: 813
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (9782..10594) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGGAAACGTTAAATTCTATTAACATTCCTAAGCGTAAAGAAGATTCACATAAAGGTGAT
    TATGGCAAAATTTTATTAATTGGTGGATCTGCTAACTTAGGTGGTGCCATTATGTTAGCG
    GCTCGTGCATGTGTATTTAGCGGTAGTGGTTTAATCACTGTAGCTACACATCCAACAAAT
    CATTCAGCATTACATTCTCGTTGCCCAGAAGCGATGGTTATTGATATTAATGATACGAAA
    ATGTTGACGAAAATGATTGAAATGACTGACAGTATACTAATTGGTCCAGGTCTTGGCGTT
    GATTTCAAAGGAAATAATGCCATTACATTCCTACTACAAAATATACAACCGCATCAAAAT
    TTAATCGTAGACGGCGATGCGATTACAATCTTTAGTAAACTGAAACCGCAATTACCTACA
    TGTCGTGTGATCTTTACACCACACCTCAAAGAATGGGAACGATTAAGTGGTATTCCTATT
    GAGGAACAGACATATGAGCGTAATCGTGAAGCAGTTGATCGTTTAGGTGCAACTGTTGTA
    CTTAAAAAACATGGTACTGAAATTTTCTTTAAAGATGAAGACTTTAAATTGACAATCGGT
    AGCCCAGCAATGGCGACTGGTGGTATGGGCGATACACTTGCTGGTATGATTACAAGCTTT
    GTCGGTCAATTTGATAACTTAAAAGAAGCGGTTATGAGTGCCACATATACACATAGTTTT
    ATTGGCGAAAACCTTGCAAAAGATATGTATGTGGTGCCACCATCAAGACTTATCAATGAA
    ATACCTTACGCAATGAAACAATTAGAAAGTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    813

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS00040 [old locus tag: SAUSA300_0007 ]
  • symbol: SAUSA300_RS00040
  • description: NAD(P)H-hydrate dehydratase
  • length: 270
  • theoretical pI: 6.5122
  • theoretical MW: 29549
  • GRAVY: -0.0525926

Function[edit | edit source]

  • reaction:
    EC 4.2.1.136?  ExPASy
    ADP-dependent NAD(P)H-hydrate dehydratase ADP + (6S)-6-beta-hydroxy-1,4,5,6-tetrahydronicotinamide adenine-dinucleotide = AMP + phosphate + NADH ADP + (6S)-6-beta-hydroxy-1,4,5,6-tetrahydronicotinamide adenine-dinucleotide phosphate = AMP + phosphate + NADPH
  • TIGRFAM:
    Unknown function General YjeF family C-terminal domain (TIGR00196; HMM-score: 185.2)
    and 2 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 28.2)
    Metabolism Energy metabolism Sugars ribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 13.5)
  • TheSEED:
  • PFAM:
    Ribokinase (CL0118) Carb_kinase; Carbohydrate kinase (PF01256; HMM-score: 194.5)
    and 1 more
    Phos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 30.4)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors: Mg2+
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.175444
    • TAT(Tat/SPI): 0.119201
    • LIPO(Sec/SPII): 0.039132
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

  • GI: 446371363 NCBI
  • RefSeq: WP_000449218 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • METLNSINIPKRKEDSHKGDYGKILLIGGSANLGGAIMLAARACVFSGSGLITVATHPTNHSALHSRCPEAMVIDINDTKMLTKMIEMTDSILIGPGLGVDFKGNNAITFLLQNIQPHQNLIVDGDAITIFSKLKPQLPTCRVIFTPHLKEWERLSGIPIEEQTYERNREAVDRLGATVVLKKHGTEIFFKDEDFKLTIGSPAMATGGMGDTLAGMITSFVGQFDNLKEAVMSATYTHSFIGENLAKDMYVVPPSRLINEIPYAMKQLES

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]