Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS01950 [old locus tag: SAUSA300_0368 ]
- pan locus tag?: SAUPAN001916000
- symbol: SAUSA300_RS01950
- pan gene symbol?: rpsR
- synonym:
- product: 30S ribosomal protein S18
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS01950 [old locus tag: SAUSA300_0368 ]
- symbol: SAUSA300_RS01950
- product: 30S ribosomal protein S18
- replicon: chromosome
- strand: +
- coordinates: 419645..419887
- length: 243
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (419645..419887) NCBI
- BioCyc: SAUSA300_RS01950 BioCyc
- MicrobesOnline: see SAUSA300_0368
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241ATGGCAGGTGGACCAAGAAGAGGCGGACGTCGTCGTAAAAAAGTATGCTATTTCACAGCA
AATGGTATTACACATATCGACTACAAAGACACTGAATTATTAAAACGTTTTATCTCAGAA
CGCGGTAAAATTTTACCACGTCGTGTAACTGGTACTTCAGCTAAATATCAACGTATGTTG
ACTACAGCTATCAAACGTTCTCGTCATATGGCATTATTACCATATGTTAAAGAAGAACAA
TAA60
120
180
240
243
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS01950 [old locus tag: SAUSA300_0368 ]
- symbol: SAUSA300_RS01950
- description: 30S ribosomal protein S18
- length: 80
- theoretical pI: 11.5763
- theoretical MW: 9309.89
- GRAVY: -0.78125
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Ribosomal proteins: synthesis and modification ribosomal protein bS18 (TIGR00165; HMM-score: 126.6)
- TheSEED: see SAUSA300_0368
- PFAM: HTH (CL0123) Ribosomal_S18; Ribosomal protein S18 (PF01084; HMM-score: 100.6)and 1 moreno clan defined SpoVIF; Stage VI sporulation protein F (PF14069; HMM-score: 13.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8662
- Cytoplasmic Membrane Score: 0.0017
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.132
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.009082
- TAT(Tat/SPI): 0.006745
- LIPO(Sec/SPII): 0.00536
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI: 446819788 NCBI
- RefSeq: WP_000897044 NCBI
- UniProt: see SAUSA300_0368
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MAGGPRRGGRRRKKVCYFTANGITHIDYKDTELLKRFISERGKILPRRVTGTSAKYQRMLTTAIKRSRHMALLPYVKEEQ
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_RS00080 50S ribosomal protein L9 [1] (data from MRSA252) SAUSA300_RS01635 5'-nucleotidase, lipoprotein e(P4) family [1] (data from MRSA252) SAUSA300_RS01940 30S ribosomal protein S6 [1] (data from MRSA252) SAUSA300_RS02610 RNA-binding protein S1 [1] (data from MRSA252) SAUSA300_RS02795 50S ribosomal protein L11 [1] (data from MRSA252) SAUSA300_RS02800 50S ribosomal protein L1 [1] (data from MRSA252) SAUSA300_RS02805 50S ribosomal protein L10 [1] (data from MRSA252) SAUSA300_RS02810 50S ribosomal protein L7/L12 [1] (data from MRSA252) SAUSA300_RS02835 30S ribosomal protein S12 [1] (data from MRSA252) SAUSA300_RS02840 30S ribosomal protein S7 [1] (data from MRSA252) SAUSA300_RS03530 LysR family transcriptional regulator [1] (data from MRSA252) SAUSA300_RS03585 hypothetical protein [1] (data from MRSA252) SAUSA300_RS04100 enolase [1] (data from MRSA252) SAUSA300_RS05350 pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SAUSA300_RS05355 pyruvate dehydrogenase E1 component subunit beta [1] (data from MRSA252) SAUSA300_RS05360 dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex [1] (data from MRSA252) SAUSA300_RS05850 cell division protein FtsA [1] (data from MRSA252) SAUSA300_RS06135 50S ribosomal protein L19 [1] (data from MRSA252) SAUSA300_RS06310 30S ribosomal protein S15 [1] (data from MRSA252) SAUSA300_RS06320 ribonuclease J 2 [1] (data from MRSA252) SAUSA300_RS07430 DNA-binding protein HU [1] (data from MRSA252) SAUSA300_RS08425 30S ribosomal protein S20 [1] (data from MRSA252) SAUSA300_RS08470 RNA-binding protein [1] (data from MRSA252) SAUSA300_RS08720 50S ribosomal protein L27 [1] (data from MRSA252) SAUSA300_RS08730 50S ribosomal protein L21 [1] (data from MRSA252) SAUSA300_RS08865 50S ribosomal protein L20 [1] (data from MRSA252) SAUSA300_RS08870 50S ribosomal protein L35 [1] (data from MRSA252) SAUSA300_RS08875 translation initiation factor IF-3 [1] (data from MRSA252) SAUSA300_RS09015 universal stress protein [1] (data from MRSA252) SAUSA300_RS09090 30S ribosomal protein S4 [1] (data from MRSA252) SAUSA300_RS11420 50S ribosomal protein L31 type B [1] (data from MRSA252) SAUSA300_RS11985 30S ribosomal protein S9 [1] (data from MRSA252) SAUSA300_RS12015 50S ribosomal protein L17 [1] (data from MRSA252) SAUSA300_RS12025 30S ribosomal protein S11 [1] (data from MRSA252) SAUSA300_RS12030 30S ribosomal protein S13 [1] (data from MRSA252) SAUSA300_RS12055 50S ribosomal protein L15 [1] (data from MRSA252) SAUSA300_RS12065 30S ribosomal protein S5 [1] (data from MRSA252) SAUSA300_RS12075 50S ribosomal protein L6 [1] (data from MRSA252) SAUSA300_RS12090 50S ribosomal protein L5 [1] (data from MRSA252) SAUSA300_RS12095 50S ribosomal protein L24 [1] (data from MRSA252) SAUSA300_RS12105 30S ribosomal protein S17 [1] (data from MRSA252) SAUSA300_RS12110 50S ribosomal protein L29 [1] (data from MRSA252) SAUSA300_RS12115 50S ribosomal protein L16 [1] (data from MRSA252) SAUSA300_RS12120 30S ribosomal protein S3 [1] (data from MRSA252) SAUSA300_RS12125 50S ribosomal protein L22 [1] (data from MRSA252) SAUSA300_RS12130 30S ribosomal protein S19 [1] (data from MRSA252) SAUSA300_RS12135 50S ribosomal protein L2 [1] (data from MRSA252) SAUSA300_RS12140 50S ribosomal protein L23 [1] (data from MRSA252) SAUSA300_RS12145 50S ribosomal protein L4 [1] (data from MRSA252) SAUSA300_RS12150 50S ribosomal protein L3 [1] (data from MRSA252) SAUSA300_RS12155 30S ribosomal protein S10 [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- data available for JSNZ
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)