From AureoWiki
Jump to navigation Jump to search
Pangenome04-0298108BA0217611819-97685071193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS07855 [old locus tag: SAUSA300_1438 ]
  • pan locus tag?: SAUPAN001246000
  • symbol: SAUSA300_RS07855
  • pan gene symbol?: int1
  • synonym:
  • product: site-specific integrase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS07855 [old locus tag: SAUSA300_1438 ]
  • symbol: SAUSA300_RS07855
  • product: site-specific integrase
  • replicon: chromosome
  • strand: +
  • coordinates: 1590733..1591938
  • length: 1206
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (1590733..1591938) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGTGGATTGAAAAATTTAAAAACAAAAATAACGAAACTAAATACAGATACTACGAGAAG
    TATAAAGATCCATACACAGATAAATGGAAGCGCGTAAGTGTTGTGTTGAACAAGAATACA
    AAACAATCTCAAAAAGAAGCAATGTTTCGTTTAGAAGAAAAAATAAAAGAAAAACTGAAC
    AACAAGTCGTCAAGCGAATTAAAAACTTTGACTTTTCACGCGCTATTAGATGAATGGCTT
    GAATATCATATAAAAACATCAGGTTCAAAGTTGACTACTCTTAATAATATAAAAATAAGA
    ATTAGAAACATTAAACGATACAGCTCTGAGAACTTGCTTTTAAACAAACTAGATACAAAA
    TATATGCAGATATTTATTAATAAATTATCAGATATCTATTCTCAAAATCAAGTAACCCGT
    CAACTCGGAGATATGAAAGGAGCTATTAAATATGCAGTTAAATTTTACAATTATCCAAAT
    GAATATTTGTTAACTAATGTCAAAATTCCTAAAAGAAGAAAAACAATAGAGGATATCGAA
    AAAGATGAATCTAAAATGTACAACTATTTAGAAATGAACCAAGTCCTACAGATACGTGAT
    CATATACTAAATGATAATAAGTTACACAAGCGAAATCGCATTTTAATTGCCAGCATCTTA
    GAAGTACAGGCTTTAACTGGTATGCGCATAGGAGAACTACAAGCACTGCAGGAAAAAGAT
    ATAGATTTATTAAACAAAACTATCAATATAACAGGTACAATTCACCGCATTAAATACGAG
    GAAGGATTCGGATACAAAGACACTACAAAGACTATAAGTTCAAAAAGAAGTATCAGCATC
    AATTCTAGAACCGTAGAAATTTTTAAAAAGATAATACTGGAAAACAAAATGTTGAAAAGA
    TGGAATTCGAGCTATGTTGACAGAGGGTTCATATTCACAACAAAAAAAGGGAATCCTTTA
    TGTAATAATCAAATCGCCGGTGTGCTTAAGAAAACTACAAAAGCTTTAAATATGAATAAG
    AAAGTTACCACGCACACATTTAGACATACACACATAACTTTATTAGTAGAAATGAATGTT
    TCTTTAAAAGCAATTATGAAAAGGGTAGGACATGTAGATGAAAAAACAACCATTCGCATA
    TATACTCATGTAACTGAAAAAATGGATAGAGAACTAACTCAAAAACTCGAAAACATTCCA
    AGTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1206

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS07855 [old locus tag: SAUSA300_1438 ]
  • symbol: SAUSA300_RS07855
  • description: site-specific integrase
  • length: 401
  • theoretical pI: 10.4693
  • theoretical MW: 47503.9
  • GRAVY: -0.709726

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair tyrosine recombinase XerC (TIGR02224; HMM-score: 76.9)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair tyrosine recombinase XerD (TIGR02225; HMM-score: 68.1)
    and 3 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair integron integrase (TIGR02249; HMM-score: 48.6)
    Genetic information processing Mobile and extrachromosomal element functions Other integron integrase (TIGR02249; HMM-score: 48.6)
    Cellular processes Cellular processes Sporulation and germination sporulation protein YabP (TIGR02892; HMM-score: 13.8)
  • TheSEED:
  • PFAM:
    DNA-mend (CL0382) Phage_integrase; Phage integrase family (PF00589; HMM-score: 94.4)
    and 1 more
    HIT (CL0265) DcpS_C; Scavenger mRNA decapping enzyme C-term binding (PF11969; HMM-score: 13.5)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.011252
    • TAT(Tat/SPI): 0.00039
    • LIPO(Sec/SPII): 0.002927
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446186896 NCBI
  • RefSeq: WP_000264751 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MWIEKFKNKNNETKYRYYEKYKDPYTDKWKRVSVVLNKNTKQSQKEAMFRLEEKIKEKLNNKSSSELKTLTFHALLDEWLEYHIKTSGSKLTTLNNIKIRIRNIKRYSSENLLLNKLDTKYMQIFINKLSDIYSQNQVTRQLGDMKGAIKYAVKFYNYPNEYLLTNVKIPKRRKTIEDIEKDESKMYNYLEMNQVLQIRDHILNDNKLHKRNRILIASILEVQALTGMRIGELQALQEKDIDLLNKTINITGTIHRIKYEEGFGYKDTTKTISSKRSISINSRTVEIFKKIILENKMLKRWNSSYVDRGFIFTTKKGNPLCNNQIAGVLKKTTKALNMNKKVTTHTFRHTHITLLVEMNVSLKAIMKRVGHVDEKTTIRIYTHVTEKMDRELTQKLENIPS

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]