From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • pan locus tag?: SAUPAN005778000
  • symbol: SAUSA300_RS12455
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • symbol: SAUSA300_RS12455
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2421826..2422950
  • length: 1125
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2421826..2422950) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAAGATAGCAATTATAGGTGCAGGCATCGGTGGATTAACAGCTGCTGCATTATTACAA
    GAACAAGGTCATACTATTAAAGTCTTTGAAAAAAATGAGTCAGTTAAAGAAATTGGCGCT
    GGGATTGGTATCGGAGATAATGTGCTTAAAAAACTAGGTAATCATGACTTAGCTAAAGGT
    ATTAAAAATGCTGGGCAAATCTTATCTACAATGACAGTGTTAGATGACAAAGATCGCCTG
    TTAACTACTGTTAAATTAAAAAGTAATACATTGAATGTGACGTTACCACGCCAAACATTA
    ATTGACATTATTAAATCTTATGTAAAAGATGACGCAATATTTACAAATCATGAAGTCACG
    CATATAGATAATGAGACAGATAAAGTTACCATACATTTCGCGGAACAAGAAAGTGAAGCA
    TTTGATTTATGTATTGGTGCTGATGGAATTCATTCTAAAGTGAGACAATCTGTAAATGCT
    GACAGTAAAGTATTATATCAAGGGTATACATGCTTTAGAGGTTTAATTGATGATATTGAT
    TTAAAGCATCCAGATTGTGCAAAAGAATACTGGGGAAGAAAAGGAAGAGTAGGTATTGTT
    CCGTTATTAAATAATCAAGCATATTGGTTCATTACAATTAACTCGAAGGAAAACAATCAT
    AAATATAGTTCGTTTGGTAAACCTCATTTGCAAGCATACTTTAATCACTATCCAAATGAA
    GTTAGAGAGATCTTAGACAAACAAAGTGAAACAGGTATCTTATTGCATAATATTTATGAT
    TTGAAACCACTCAAATCTTTTGTTTATGGTCGTACTATTTTACTAGGAGATGCAGCACAT
    GCGACAACGCCTAATATGGGGCAAGGTGCTGGACAAGCAATGGAAGATGCTATCGTATTA
    GTAAATTGTTTTAACGCATACGACTTTGAAAAAGCATTACAGCGTTATGATAAAATACGT
    GTCAAACATACTGCAAAAGTAATTAAGCGTTCTAGAAAAATCGGTAAAATTGCCCAATAT
    CGTAGTCGTTTATTTGTTGCAGTTAGAAATCGTATTATGAAAATGATGCCAAATGCATTA
    GCAGCTGGACAAACTAAATTCTTATATAAATCGAAAGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1125

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS12455 [old locus tag: SAUSA300_2255 ]
  • symbol: SAUSA300_RS12455
  • description: hypothetical protein
  • length: 374
  • theoretical pI: 9.81248
  • theoretical MW: 41890
  • GRAVY: -0.317914

Function[edit | edit source]

  • reaction:
    EC 1.14.13.-?  ExPASy
  • TIGRFAM:
    salicylate 1-monooxygenase (TIGR03219; EC 1.14.13.1; HMM-score: 117.7)
    and 26 more
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 87.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 80.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 56.8)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 48.1)
    ubiquinone biosynthesis monooxygenase COQ6 (TIGR01989; EC 1.14.13.-; HMM-score: 45.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 43)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 26.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 25.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 23.6)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 22.6)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 21.3)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 21)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 18.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 18.8)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 18.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 17.5)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 17.3)
    9,9'-di-cis-zeta-carotene desaturase (TIGR02732; EC 1.3.5.6; HMM-score: 17.1)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 16.9)
    putative phosphonate catabolism associated alcohol dehydrogenase (TIGR03366; HMM-score: 15.7)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 14.6)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 14.4)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 13.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02028; HMM-score: 13.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02731; EC 1.14.99.-; HMM-score: 13)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 9.8)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) FAD_binding_3; FAD binding domain (PF01494; HMM-score: 72.4)
    and 19 more
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 33.3)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 23.3)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 22.3)
    SE; Squalene epoxidase (PF08491; HMM-score: 21.8)
    Amino_oxidase; Flavin containing amine oxidoreductase (PF01593; HMM-score: 21.6)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 19.7)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 18.2)
    Thi4; Thi4 family (PF01946; HMM-score: 17.2)
    Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 16.2)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 16.2)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 16)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 15.7)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 15.1)
    Trp_halogenase; Tryptophan halogenase (PF04820; HMM-score: 13.7)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 13.5)
    ApbA; Ketopantoate reductase PanE/ApbA (PF02558; HMM-score: 13.3)
    TrkA_N; TrkA-N domain (PF02254; HMM-score: 12.8)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 12.8)
    NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 11.4)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.384671
    • TAT(Tat/SPI): 0.003362
    • LIPO(Sec/SPII): 0.051479
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446606795 NCBI
  • RefSeq: WP_000684141 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MKIAIIGAGIGGLTAAALLQEQGHTIKVFEKNESVKEIGAGIGIGDNVLKKLGNHDLAKGIKNAGQILSTMTVLDDKDRLLTTVKLKSNTLNVTLPRQTLIDIIKSYVKDDAIFTNHEVTHIDNETDKVTIHFAEQESEAFDLCIGADGIHSKVRQSVNADSKVLYQGYTCFRGLIDDIDLKHPDCAKEYWGRKGRVGIVPLLNNQAYWFITINSKENNHKYSSFGKPHLQAYFNHYPNEVREILDKQSETGILLHNIYDLKPLKSFVYGRTILLGDAAHATTPNMGQGAGQAMEDAIVLVNCFNAYDFEKALQRYDKIRVKHTAKVIKRSRKIGKIAQYRSRLFVAVRNRIMKMMPNALAAGQTKFLYKSKEK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]