From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS14130 [old locus tag: SAUSA300_2545 ]
  • pan locus tag?: SAUPAN006313000
  • symbol: SAUSA300_RS14130
  • pan gene symbol?: betA
  • synonym:
  • product: oxygen-dependent choline dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS14130 [old locus tag: SAUSA300_2545 ]
  • symbol: SAUSA300_RS14130
  • product: oxygen-dependent choline dehydrogenase
  • replicon: chromosome
  • strand: -
  • coordinates: 2749297..2751006
  • length: 1710
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (2749297..2751006) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    ATGAGTAACAAAAACAAATCATATGATTATGTCATCATTGGAGGAGGCAGTGCAGGTTCT
    GTACTAGGTAATCGTCTGAGTGAAGATAAAGATAAAGAAGTCTTAGTATTAGAAGCGGGT
    CGCAGTGATTATTTTTGGGATTTATTTATCCAAATGCCTGCTGCGTTAATGTTCCCTTCA
    GGCAATAAATTTTACGATTGGATTTATTCAACAGATGAAGAACCACATATGGGCGGTCGT
    AAAGTAGCACATGCCCGAGGTAAAGTTTTAGGTGGATCAAGTTCGATTAATGGCATGATT
    TATCAACGTGGTAATCCAATGGACTATGAAGGCTGGGCAGAACCAGAAGGTATGGAAACT
    TGGGATTTTGCGCACTGTTTACCGTATTTTAAAAAATTAGAAAAAACATACGGTGCAGCG
    CCTTATGATAAATTTAGAGGCCATGATGGACCAATTAAGTTAAAACGAGGGCCAGCAACG
    AATCCTTTATTCCAGTCATTCTTTGATGCAGGTGTTGAAGCAGGCTATCATAAAACACCT
    GATGTGAATGGATTTAGACAAGAAGGTTTTGGACCGTTCGATAGTCAAGTACATCGTGGT
    CGCCGAATGTCAGCTTCAAGAGCATATTTACATCCAGCGATGAAGCGTAAAAACTTAACC
    GTTGAAACACGTGCCTTTGTAACTGAAATTCATTATGAAGGTAGAAGAGCAACTGGTGTT
    ACGTATAAGAAAAATGGCAAACTACATACCATCGATGCTAATGAAGTCATTTTGTCTGGT
    GGGGCATTCAATACGCCACAATTACTACAATTATCTGGTATCGGTGATTCAGAGTTCCTA
    AAATCAAAAGGCATTGAGCCACGTGTTCATTTACCTGGTGTGGGTGAAAACTTTGAAGAT
    CACTTAGAGGTATACATTCAACATAAATGTAAGGAACCTGTATCATTACAGCCAAGCTTA
    GATATCAAGCGCATGCCATTTATTGGTTTACAATGGATTTTCACACGTACAGGTGCAGCA
    GCATCTAACCATTTTGAAGGTGGCGGATTTGTACGTTCAAATAACGAAGTTGATTATCCT
    AACTTAATGTTCCATTTCTTACCAATAGCTGTAAGATATGATGGTCAAAAGGCAGCGGTC
    GCACATGGTTATCAAGTTCACGTAGGACCAATGTATTCAAACTCTCGTGGTAGCTTGAAA
    ATCAAATCTAAAGATCCATTCGAAAAACCAAGTATCCGCTTTAATTATTTATCAACAGAA
    GAAGATAAAAAAGAATGGGTAGAAGCAATTCGTGTAGCAAGAAATATCTTATCTCAAAAA
    GCAATGGATCCATTCAATGGTGGAGAAATTTCACCAGGACCAGAAGTGCAAACAGACGAA
    GAAATTCTTGATTGGGTTCGTAGAGATGGTGAAACAGCATTACACCCATCTTGTAGTGCT
    AAAATGGGTCCTGCTTCAGATCCAATGGCAGTAGTTGACCCGTTAACAATGAAAGTCCAC
    GGTATGGAAAATTTACGTGTAGTTGATGCATCAGCTATGCCACGTACGACAAATGGCAAT
    ATACACGCACCTGTTTTAATGTTAGCTGAAAAAGCAGCAGACATTATACGTGGCAGAAAG
    CCTTTAGAGCCACAATATATTGATTATTATAAGCATGGTGTTCATGATGAAAATGAAGGT
    GCAATCGAAGTAAAACCATACGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1710

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS14130 [old locus tag: SAUSA300_2545 ]
  • symbol: SAUSA300_RS14130
  • description: oxygen-dependent choline dehydrogenase
  • length: 569
  • theoretical pI: 7.40617
  • theoretical MW: 63609.6
  • GRAVY: -0.541476

Function[edit | edit source]

  • reaction:
    EC 1.2.1.8?  ExPASy
    Betaine-aldehyde dehydrogenase Betaine aldehyde + NAD+ + H2O = betaine + NADH
    EC 1.1.99.1?  ExPASy
    Choline dehydrogenase Choline + acceptor = betaine aldehyde + reduced acceptor
  • TIGRFAM:
    Cellular processes Cellular processes Adaptations to atypical conditions choline dehydrogenase (TIGR01810; EC 1.1.99.1; HMM-score: 934.7)
    and 10 more
    dehydrogenase, Rv0697 family (TIGR03970; EC 1.-.-.-; HMM-score: 321.7)
    Unknown function Enzymes of unknown specificity GMC family mycofactocin-associated oxidreductase (TIGR04542; EC 1.-.-.-; HMM-score: 115.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridine nucleotides L-aspartate oxidase (TIGR00551; EC 1.4.3.16; HMM-score: 17.4)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 15.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 14.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 14.8)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 12.2)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 12.1)
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 11.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.1)
  • TheSEED:
  • PFAM:
    NADP_Rossmann (CL0063) GMC_oxred_N; GMC oxidoreductase (PF00732; HMM-score: 263.4)
    and 8 more
    no clan defined GMC_oxred_C; GMC oxidoreductase (PF05199; HMM-score: 125.9)
    NADP_Rossmann (CL0063) Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 30.1)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 25)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 19.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 17.7)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 17.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 14.1)
    Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 12.1)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.009996
    • TAT(Tat/SPI): 0.000463
    • LIPO(Sec/SPII): 0.004264
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 445988666 NCBI
  • RefSeq: WP_000066521 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MSNKNKSYDYVIIGGGSAGSVLGNRLSEDKDKEVLVLEAGRSDYFWDLFIQMPAALMFPSGNKFYDWIYSTDEEPHMGGRKVAHARGKVLGGSSSINGMIYQRGNPMDYEGWAEPEGMETWDFAHCLPYFKKLEKTYGAAPYDKFRGHDGPIKLKRGPATNPLFQSFFDAGVEAGYHKTPDVNGFRQEGFGPFDSQVHRGRRMSASRAYLHPAMKRKNLTVETRAFVTEIHYEGRRATGVTYKKNGKLHTIDANEVILSGGAFNTPQLLQLSGIGDSEFLKSKGIEPRVHLPGVGENFEDHLEVYIQHKCKEPVSLQPSLDIKRMPFIGLQWIFTRTGAAASNHFEGGGFVRSNNEVDYPNLMFHFLPIAVRYDGQKAAVAHGYQVHVGPMYSNSRGSLKIKSKDPFEKPSIRFNYLSTEEDKKEWVEAIRVARNILSQKAMDPFNGGEISPGPEVQTDEEILDWVRRDGETALHPSCSAKMGPASDPMAVVDPLTMKVHGMENLRVVDASAMPRTTNGNIHAPVLMLAEKAADIIRGRKPLEPQYIDYYKHGVHDENEGAIEVKPYAK

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]