From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS11635 [old locus tag: SA2023 ]
  • pan locus tag?: SAUPAN005676000
  • symbol: SA_RS11635
  • pan gene symbol?: rpoA
  • synonym:
  • product: DNA-directed RNA polymerase subunit alpha

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS11635 [old locus tag: SA2023 ]
  • symbol: SA_RS11635
  • product: DNA-directed RNA polymerase subunit alpha
  • replicon: chromosome
  • strand: -
  • coordinates: 2295111..2296055
  • length: 945
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (2295111..2296055) NCBI
  • BioCyc: G1G21-2357 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGATAGAAATCGAAAAACCTAGAATTGAGACAATTGAAATTAGTGAAGATGCTAAATTC
    GGTAAGTTCGTTGTTGAACCACTAGAACGTGGCTACGGTACTACACTAGGAAACTCCTTA
    CGTCGTATCCTACTATCTTCATTACCAGGTGCAGCCGTTAAGTATATTGAAATTGAGGGA
    GTTTTACATGAATTCTCAGCAGTAGACAATGTAGTTGAAGATGTTTCTACAATTATTATG
    AACATTAAACAATTAGCATTGAAAATTTACTCTGAAGAAGATAAAACTTTAGAAATTGAT
    GTACGTGATGAAGGCGAAGTAACAGCAAGCGACATTACACATGATAGTGATGTTGAAATT
    TTAAACCCAGAGCTTAAAATTGCAACAGTATCTAAAGGTGGTCACTTAAAAATTCGTCTA
    GTTGCTAACAAGGGTAGAGGTTACGCATTAGCAGAACAAAATAATACTAGTGATTTACCA
    ATTGGTGTAATCCCTGTTGATTCATTGTATTCACCTGTTGAACGTGTGAACTATACTGTT
    GAAAATACACGTGTAGGTCAAAGCAGTGATTTTGATAAATTAACATTGGATGTTTGGACT
    AATGGTTCAATCACACCACAAGAATCAGTTTCATTAGCAGCAAAAATAATGACTGAACAC
    TTGAATATCTTCGTTGGTCTTACTGATGAAGCGCAAAACGCTGAAATCATGATTGAAAAA
    GAAGAAGATCAAAAAGAAAAAGTATTAGAAATGTCTATTGAAGAATTAGACTTATCTGTA
    CGTTCATATAACTGCTTAAAACGCGCAGGAATCAATTCTGTTCAAGAGTTAGCTGACAAA
    TCTGAAGCTGACATGATGAAAGTGCGTAATTTAGGTCGTAAATCTTTAGAAGAAGTTAAA
    TACAAATTAGAAGATTTAGGATTAGGATTAAGAAAAGAAGATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    945

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS11635 [old locus tag: SA2023 ]
  • symbol: SA_RS11635
  • description: DNA-directed RNA polymerase subunit alpha
  • length: 314
  • theoretical pI: 4.39431
  • theoretical MW: 35011.5
  • GRAVY: -0.302229

Function[edit | edit source]

  • reaction:
    EC 2.7.7.6?  ExPASy
    DNA-directed RNA polymerase Nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1)
  • TIGRFAM:
    Genetic information processing Transcription DNA-dependent RNA polymerase DNA-directed RNA polymerase, alpha subunit (TIGR02027; EC 2.7.7.6; HMM-score: 390.4)
  • TheSEED:
  • PFAM:
    HHH (CL0198) RNA_pol_A_CTD; Bacterial RNA polymerase, alpha chain C terminal domain (PF03118; HMM-score: 98.7)
    RBP11-like (CL0509) RNA_pol_L; RNA polymerase Rpb3/Rpb11 dimerisation domain (PF01193; HMM-score: 84)
    no clan defined RNA_pol_A_bac; RNA polymerase Rpb3/RpoA insert domain (PF01000; HMM-score: 79.4)
    and 2 more
    HHH (CL0198) HHH_5; Helix-hairpin-helix domain (PF14520; HMM-score: 14.7)
    no clan defined PASTA; PASTA domain (PF03793; HMM-score: 12.1)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [2] (data from MRSA252)
    SA_RS04160enolase  [2] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS06235elongation factor Ts  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [2] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [2] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [2] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [2] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007843
    • TAT(Tat/SPI): 0.013642
    • LIPO(Sec/SPII): 0.000555
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446491795 NCBI
  • RefSeq: WP_000569649 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MIEIEKPRIETIEISEDAKFGKFVVEPLERGYGTTLGNSLRRILLSSLPGAAVKYIEIEGVLHEFSAVDNVVEDVSTIIMNIKQLALKIYSEEDKTLEIDVRDEGEVTASDITHDSDVEILNPELKIATVSKGGHLKIRLVANKGRGYALAEQNNTSDLPIGVIPVDSLYSPVERVNYTVENTRVGQSSDFDKLTLDVWTNGSITPQESVSLAAKIMTEHLNIFVGLTDEAQNAEIMIEKEEDQKEKVLEMSIEELDLSVRSYNCLKRAGINSVQELADKSEADMMKVRNLGRKSLEEVKYKLEDLGLGLRKED

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]