From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS11705 [old locus tag: SA2035 ]
  • pan locus tag?: SAUPAN005690000
  • symbol: SA_RS11705
  • pan gene symbol?: rplE
  • synonym:
  • product: 50S ribosomal protein L5

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS11705 [old locus tag: SA2035 ]
  • symbol: SA_RS11705
  • product: 50S ribosomal protein L5
  • replicon: chromosome
  • strand: -
  • coordinates: 2302206..2302745
  • length: 540
  • essential: yes [1] DEG other strains

⊟Accession numbers[edit | edit source]

  • Location: NC_002745 (2302206..2302745) NCBI
  • BioCyc: G1G21-2371 BioCyc
  • MicrobesOnline: see SA2035

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    TTGAACCGTTTAAAAGAAAAGTTTAACACTGAAGTTACTGAAAACTTAATGAAAAAATTC
    AATTATAGTTCAGTAATGGAAGTACCAAAAATAGATAAAATCGTTGTGAACATGGGTGTA
    GGTGACGCAGTACAAAATTCTAAAGTATTAGACAATGCTGTTGAAGAATTAGAATTGATC
    ACTGGTCAAAAACCATTAGTAACTAAAGCTAAAAAATCAATCGCGACTTTCCGTTTACGT
    GAAGGTATGCCAATCGGTGCGAAAGTAACACTTCGCGGTGAAAGAATGTATGAATTCTTA
    GACAAATTAATTTCAGTATCATTACCACGTGTACGTGACTTCCAAGGTGTTTCTAAAAAA
    GCATTTGACGGACGCGGTAACTACACTTTAGGTGTTAAAGAACAATTAATTTTCCCAGAA
    ATCGACTATGATAAAGTAAGTAAAGTTAGAGGAATGGATATTGTTATCGTAACGACTGCT
    AACACTGATGAAGAAGCTCGTGAATTGTTAGCTAACTTCGGTATGCCATTCCGTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540

⊟Protein[edit | edit source]

Protein Data Bank: 4WCE
Protein Data Bank: 4WF9
Protein Data Bank: 4WFA
Protein Data Bank: 4WFB
Protein Data Bank: 5HKV
Protein Data Bank: 5HL7
Protein Data Bank: 5LI0
Protein Data Bank: 5ND8
Protein Data Bank: 5ND9
Protein Data Bank: 5NRG
Protein Data Bank: 5TCU

⊟General[edit | edit source]

  • locus tag: SA_RS11705 [old locus tag: SA2035 ]
  • symbol: SA_RS11705
  • description: 50S ribosomal protein L5
  • length: 179
  • theoretical pI: 9.95029
  • theoretical MW: 20266.5
  • GRAVY: -0.305587

⊟Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines urocanate hydratase (TIGR01228; EC 4.2.1.49; HMM-score: 10.8)
  • TheSEED: see SA2035
  • PFAM:
    no clan defined Ribosomal_L5_C; ribosomal L5P family C-terminus (PF00673; HMM-score: 142.8)
    and 3 more
    S24e_L23_L15e (CL0652) Ribosomal_L5; Ribosomal protein L5 (PF00281; HMM-score: 100.3)
    no clan defined Urocanase_N; Urocanase N-terminal domain (PF17391; HMM-score: 14.7)
    DUF2660; Protein of unknown function (DUF2660) (PF10859; HMM-score: 13.1)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007059
    • TAT(Tat/SPI): 0.000325
    • LIPO(Sec/SPII): 0.000455
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNRLKEKFNTEVTENLMKKFNYSSVMEVPKIDKIVVNMGVGDAVQNSKVLDNAVEELELITGQKPLVTKAKKSIATFRLREGMPIGAKVTLRGERMYEFLDKLISVSLPRVRDFQGVSKKAFDGRGNYTLGVKEQLIFPEIDYDKVSKVRGMDIVIVTTANTDEEARELLANFGMPFRK

⊟Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS03480dihydroxyacetone kinase subunit L  [2] (data from MRSA252)
    SA_RS03910ribonucleotide-diphosphate reductase subunit alpha  [2] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS04160enolase  [2] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [2] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [2] (data from MRSA252)
    SA_RS05430translational GTPase TypA  [2] (data from MRSA252)
    SA_RS05945carbamoyl-phosphate synthase large chain  [2] (data from MRSA252)
    SA_RS07205serine/threonine dehydratase  [2] (data from MRSA252)
    SA_RS0740030S ribosomal protein S1  [2] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS09055S-adenosylmethionine synthase  [2] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [2] (data from MRSA252)
    SA_RS10765serine phosphatase  [2] (data from MRSA252)
    SA_RS11060aldehyde dehydrogenase family protein  [2] (data from MRSA252)
    SA_RS11345chromosome partitioning protein ParA  [2] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [2] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA_RS13920arginine deiminase  [2] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SA_RS11705&oldid=100153"