From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS05430 [old locus tag: SA0959 ]
  • pan locus tag?: SAUPAN003336000
  • symbol: SA_RS05430
  • pan gene symbol?: typA
  • synonym:
  • product: translational GTPase TypA

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS05430 [old locus tag: SA0959 ]
  • symbol: SA_RS05430
  • product: translational GTPase TypA
  • replicon: chromosome
  • strand: +
  • coordinates: 1086094..1087941
  • length: 1848
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (1086094..1087941) NCBI
  • BioCyc: G1G21-1094 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGACTAATAAAAGAGAAGATGTCCGCAATATAGCAATTATTGCTCACGTTGACCATGGT
    AAAACAACTTTAGTAGATGAGTTGTTAAAACAATCTGGTATATTCAGAGAAAATGAACAT
    GTCGATGAACGTGCAATGGACTCTAACGATATCGAAAGAGAGCGTGGAATTACGATTCTA
    GCCAAAAATACGGCTGTTGATTATAAAGGTACACGTATTAATATTTTGGATACACCAGGA
    CATGCAGACTTTGGTGGAGAAGTAGAACGTATTATGAAAATGGTTGATGGGGTTGTCTTA
    GTAGTAGATGCGTATGAAGGTACAATGCCTCAAACACGTTTTGTACTTAAAAAAGCGCTA
    GAACAAAACCTGAAACCTGTTGTTGTTGTTAATAAAATTGATAAACCATCAGCACGTCCA
    GAGGGTGTTGTAGATGAAGTTTTAGATTTATTTATTGAATTAGAAGCAAACGATGAACAA
    TTAGAATTCCCTGTTGTTTATGCTTCAGCAGTAAATGGAACAGCTAGCTTAGATCCTGAA
    AAACAAGATGATAATTTACAATCATTATATGAAACAATTATTGATTATGTACCAGCTCCA
    ATTGATAACAGTGATGAGCCATTACAATTCCAAGTAGCATTGTTGGACTACAATGATTAT
    GTTGGACGTATTGGTATTGGTCGTGTATTCAGAGGTAAAATGCGTGTCGGAGATAATGTA
    TCACTAATTAAATTAGACGGTACAGTGAAAAACTTCCGTGTAACTAAAATCTTTGGTTAC
    TTTGGATTAAAACGTTTAGAAATTGAAGAAGCACAAGCTGGAGATTTAATTGCTGTTTCA
    GGTATGGAAGACATTAATGTTGGTGAAACTGTAACACCACATGACCATCAAGAAGCATTG
    CCAGTTCTACGTATTGATGAGCCTACTCTTGAAATGACATTTAAAGTTAACAATTCTCCA
    TTTGCTGGCCGTGAAGGTGACTTTGTAACAGCACGTCAAATTCAAGAACGTTTAAATCAA
    CAATTAGAAACAGATGTATCTTTGAAAGTTTCTAACACAGATTCTCCAGATACATGGGTA
    GTTGCTGGTCGCGGTGAATTGCATTTATCAATCCTTATTGAAAATATGCGTCGTGAAGGT
    TATGAATTACAAGTTTCAAAACCACAAGTAATTATTAAAGAAATAGATGGTGTAATGTGT
    GAACCATTTGAACGTGTGCAATGTGAAGTGCCACAAGAAAATGCAGGTGCTGTTATTGAA
    TCATTAGGTGCACGTAAAGGTGAAATGGTTGATATGACTACAACTGATAATGGACTTACA
    CGTTTAATCTTTAATGTACCGGCTCGTGGTATGATTGGTTATACGACTGAATTTATGTCA
    ATGACAAGAGGTTACGGTATTATTAACCATACATTTGAAGAATTTAGACCACGTATTAAA
    GCACAAATTGGCGGTCGTCGTAATGGTGCATTAATTTCAATGGATCAAGGTTCTGCAAGT
    ACTTATGCCATTTTGGGACTTGAAGATAGAGGTGTAAACTTCATGGAACCTGGTACTGAA
    GTTTATGAAGGTATGATTGTTGGTGAACATAATCGTGAAAATGATTTAACTGTTAACATC
    ACTAAAACAAAACATCAAACTAACGTACGTTCTGCAACGAAAGACCAAACACAAACAATG
    AATAGACCGCGTATTCTAACATTGGAAGAAGCGTTACAATTCATTAATGATGATGAACTT
    GTTGAGGTTACACCAGAAAGTATACGTTTAAGAAAGAAAATTTTAAACAAAAATGTTCGT
    GAAAAAGAAGCAAAGCGTATCAAACAAATGATGCAAGAAAACGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1848

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS05430 [old locus tag: SA0959 ]
  • symbol: SA_RS05430
  • description: translational GTPase TypA
  • length: 615
  • theoretical pI: 4.66309
  • theoretical MW: 69195
  • GRAVY: -0.417724

Function[edit | edit source]

  • TIGRFAM:
    Cellular processes Cellular processes Adaptations to atypical conditions GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    Genetic information processing Protein synthesis Translation factors GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    Signal transduction Regulatory functions Other GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    and 18 more
    Genetic information processing Protein synthesis Translation factors translation elongation factor G (TIGR00484; HMM-score: 220.7)
    Genetic information processing Protein synthesis Translation factors translation elongation factor aEF-2 (TIGR00490; HMM-score: 211.9)
    Unknown function General elongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 209.7)
    Genetic information processing Protein synthesis Translation factors translation elongation factor Tu (TIGR00485; HMM-score: 100.2)
    Genetic information processing Protein synthesis Translation factors peptide chain release factor 3 (TIGR00503; HMM-score: 92.9)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 85)
    Genetic information processing Protein synthesis Translation factors selenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 75.6)
    Genetic information processing Protein synthesis Translation factors translation initiation factor IF-2 (TIGR00487; HMM-score: 68)
    Genetic information processing Protein synthesis Translation factors translation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 67.8)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 48.7)
    Genetic information processing Protein synthesis Translation factors translation initiation factor aIF-2 (TIGR00491; HMM-score: 44.2)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 35.7)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 26.2)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 13.7)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 13.5)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 13.3)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 13)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 12.3)
  • TheSEED: see SA0959
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 192.4)
    and 10 more
    EF-G_C (CL0437) EFG_C; Elongation factor G C-terminus (PF00679; HMM-score: 78.6)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 41.2)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 31.6)
    EF-G_C (CL0437) EFG_II; Elongation Factor G, domain II (PF14492; HMM-score: 30.2)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 20.3)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 19.9)
    Septin; Septin (PF00735; HMM-score: 17.4)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 13.6)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 13.5)
    Ras; Ras family (PF00071; HMM-score: 12.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002979
    • TAT(Tat/SPI): 0.000328
    • LIPO(Sec/SPII): 0.000462
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446104799 NCBI
  • RefSeq: WP_000182654 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MTNKREDVRNIAIIAHVDHGKTTLVDELLKQSGIFRENEHVDERAMDSNDIERERGITILAKNTAVDYKGTRINILDTPGHADFGGEVERIMKMVDGVVLVVDAYEGTMPQTRFVLKKALEQNLKPVVVVNKIDKPSARPEGVVDEVLDLFIELEANDEQLEFPVVYASAVNGTASLDPEKQDDNLQSLYETIIDYVPAPIDNSDEPLQFQVALLDYNDYVGRIGIGRVFRGKMRVGDNVSLIKLDGTVKNFRVTKIFGYFGLKRLEIEEAQAGDLIAVSGMEDINVGETVTPHDHQEALPVLRIDEPTLEMTFKVNNSPFAGREGDFVTARQIQERLNQQLETDVSLKVSNTDSPDTWVVAGRGELHLSILIENMRREGYELQVSKPQVIIKEIDGVMCEPFERVQCEVPQENAGAVIESLGARKGEMVDMTTTDNGLTRLIFNVPARGMIGYTTEFMSMTRGYGIINHTFEEFRPRIKAQIGGRRNGALISMDQGSASTYAILGLEDRGVNFMEPGTEVYEGMIVGEHNRENDLTVNITKTKHQTNVRSATKDQTQTMNRPRILTLEEALQFINDDELVEVTPESIRLRKKILNKNVREKEAKRIKQMMQENE

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [2] (data from MRSA252)
    SA_RS02710cysteine synthase  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS03645hypothetical protein  [2] (data from MRSA252)
    SA_RS03665MarR family transcriptional regulator  [2] (data from MRSA252)
    SA_RS04020ribosomal subunit interface protein  [2] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [2] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [2] (data from MRSA252)
    SA_RS04160enolase  [2] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS0612530S ribosomal protein S16  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS06235elongation factor Ts  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [2] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [2] (data from MRSA252)
    SA_RS08630acetate kinase  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS09810non-heme ferritin  [2] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [2] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [2] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [2] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [2] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [2] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [2] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS13705L-lactate dehydrogenase  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [2] (data from MRSA252)
    SA_RS13920arginine deiminase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]