From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS13540 [old locus tag: SA2363 ]
  • pan locus tag?: SAUPAN006251000
  • symbol: SA_RS13540
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS13540 [old locus tag: SA2363 ]
  • symbol: SA_RS13540
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2654154..2654453
  • length: 300
  • essential: no DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (2654154..2654453) NCBI
  • BioCyc: SA_RS13540 BioCyc
  • MicrobesOnline: see SA2363

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    ATGTCTTTAAATAAAGAGCAAAGACGCATCACAGCTGAAGAGTTGCAAGCACATTTTGAA
    GAATCTACCTTATCGGTTCAAATGATTGCTGAAAAACTGAATGTCACTACAGAAGATGTG
    GAAAAAGTATTAGCTATGACAGCGCCACTAGGCATTTTTAGTCATCAATTACAACGATTT
    ATTCATTTAGTATGGGATGTCAGAGATGTAATAAACGACAATATTAAAGGAAATGGACAA
    ACACCAGAACCATATACGTATTTAAAAGGTGAAAAAGAGGACTATTGGTTTTTAAGATAA
    60
    120
    180
    240
    300


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS13540 [old locus tag: SA2363 ]
  • symbol: SA_RS13540
  • description: hypothetical protein
  • length: 99
  • theoretical pI: 4.88437
  • theoretical MW: 11594.1
  • GRAVY: -0.50404

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions phage-associated protein, BcepMu gp16 family (TIGR04111; HMM-score: 19.1)
  • TheSEED: see SA2363
  • PFAM:
    HTH (CL0123) DUF2316; Uncharacterized protein conserved in bacteria (DUF2316) (PF10078; HMM-score: 106.1)
    and 8 more
    PCI; PCI domain (PF01399; HMM-score: 17.3)
    HTH_Cmi2_C; Cmi2, C-terminal (PF24270; HMM-score: 14.3)
    HTH_11; HTH domain (PF08279; HMM-score: 14)
    no clan defined DUF2774; Protein of unknown function (DUF2774) (PF11242; HMM-score: 13.7)
    HTH (CL0123) HTH_69; Winged helix-turn-helix domain (PF22979; HMM-score: 13.4)
    no clan defined DUF2999; Protein of unknown function (DUF2999) (PF11212; HMM-score: 13.2)
    HTH (CL0123) IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 13.1)
    RuvB_C; RuvB C-terminal winged helix domain (PF05491; HMM-score: 12.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9585
    • Cytoplasmic Membrane Score: 0.0274
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.014
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00139
    • TAT(Tat/SPI): 0.000342
    • LIPO(Sec/SPII): 0.000248
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MSLNKEQRRITAEELQAHFEESTLSVQMIAEKLNVTTEDVEKVLAMTAPLGIFSHQLQRFIHLVWDVRDVINDNIKGNGQTPEPYTYLKGEKEDYWFLR

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]


Relevant publications[edit | edit source]