From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0143 [new locus tag: NWMN_RS00785 ]
  • pan locus tag?: SAUPAN001056000
  • symbol: NWMN_0143
  • pan gene symbol?:
  • synonym:
  • product: oligopeptide ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0143 [new locus tag: NWMN_RS00785 ]
  • symbol: NWMN_0143
  • product: oligopeptide ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 180379..181971
  • length: 1593
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    ATGTCAAATTTATTAGAAGTCAACAGTCTGAATGTACAATTCAATTATGATGAAACTACA
    GTTCAAGCGGTAAAAAACGTCTCTTTCGAATTACGAAAAAAACATATCCTAGGTATTGTT
    GGTGAATCAGGATCAGGAAAAAGTATTACCGCTAAATCTATTTTAGGGCTACTACCAGAT
    TATCCAGATCACACATTAACAGGAGAAATTATTTTTAATGGGCAATCGTTAAATAATTTA
    TCAACTTCAGCGTTACAACAAATTCGAGGTAAGGATATTTCAATGATTTTTCAAGATCCA
    CTCTCTTCGTTGAATCCAAGATTAACGATTGGCAAACAAATTACAGAAGTAATATTTCAA
    CATAAACGTGTATCTAAATCTGAAGCAAAGTCGATGACAATAGACATTTTAGAAAAAGTA
    GGTATAAAACATGCAACTCGACAATTTGATGCTTATCCACATGAACTTTCTGGTGGTATG
    CGTCAACGTGTCATGATAGCAATGGCATTGATTTTAAAGCCACAAATTTTAATCGCAGAT
    GAACCAACAACGGCATTAGATGCCAGTACACAAAATCAATTACTGCAGTTAATGAAGTCC
    CTTTATGAGTACACAGAAACATCTATTATTTTTATCACTCACGATTTAGGCGCTGTGTAT
    CAATTTTGCGACGATGTGATTGTAATGAAAGATGGAAGTGTCGTTGAAAGTGGCACGGTT
    GAAAGTATTTTTAAATCGCCACAACATACCTATACAAAACGCTTAATAGATGCGATTCCT
    GATATTCATCAAACGCGTCCGCCAAGACCGTTAAACAATGATATTTTATTAAAATTCGAT
    CGCGTGAGCGTGGATTACACATCACCGAGTGGCAGCCTATACCGAGCAGTTAATGATATT
    AACTTGGCTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGGAAA
    TCGACATTAGCTAAGACGGTCGTCGGTCTAAAGGAAGTGTCAGAAGGCTTTATTTGGTAT
    AACGAATTACCATTAAGTTTATTTAAAGATGATGAATTGAAATCTTTACGACAAGAGATA
    CAAATGATTTTTCAAGATCCATTCGCATCTATTAATCCAAGATTTAAAGTCATTGATGTG
    ATTAAACGACCACTAATCATTCATGGGAAAGTCAAAGATAATGATGACATTATTAAAACT
    GTCGTATCGTTGTTAGAAAAGGTTGGCCTAGATCAAACTTTCTTATATCGCTATCCACAC
    GAATTATCTGGTGGGCAACGTCAGCGTGTAAGTATCGCGAGAGCACTTGCTGTTGAACCT
    AAAGTGATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATC
    ATCGAGTTATTAAAACAATTACAGTTAGACTTCGGCATCACTTATTTATTCATCACACAT
    GACATGGGTGTTATCAATGAAATATGTGATCGCGTTGCAGTTATGAAAAATGGCGAAATC
    GTTGAACTGAATAACACAGAAGATATTATCAAACATCCGCAGTCAGACTATGCAAAGCAA
    CTTATTTCAGAAGTAGCAGTTATTGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1593

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0143 [new locus tag: NWMN_RS00785 ]
  • symbol: NWMN_0143
  • description: oligopeptide ABC transporter ATP-binding protein
  • length: 530
  • theoretical pI: 6.25442
  • theoretical MW: 59175.8
  • GRAVY: -0.08

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 447.4)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 410.8)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 332.1)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 325.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 323.7)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 305.3)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 290)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 289.6)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 278.5)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 276.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 274.8)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 271)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 267.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 261.2)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 259.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 245.5)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 230.8)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 230.1)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 226)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 214.9)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 212.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 212.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 211.6)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 207.8)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 192.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 191.6)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 184.2)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 181.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 180.7)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 179.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 179)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 178.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 177.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 173.9)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 169.9)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 165.8)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 161.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 159.3)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 153.9)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 142.1)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 138.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 135.6)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 132.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 110.5)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 96.2)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 85.1)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 85.1)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 80.8)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 77.9)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.4)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 68.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesoligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 42)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesSalvage of nucleosides and nucleotidesuridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 19.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 17.5)
    MetabolismCentral intermediary metabolismSulfur metabolismadenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 15.2)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 13.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion protein EssC (TIGR03928; HMM-score: 11.8)
    MetabolismCentral intermediary metabolismNitrogen fixationNif-specific regulatory protein (TIGR01817; HMM-score: 11.4)
    Signal transductionRegulatory functionsDNA interactionsNif-specific regulatory protein (TIGR01817; HMM-score: 11.4)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 8.7)
  • TheSEED:  
    Sulfur MetabolismOrganic sulfur assimilationUtilization of glutathione as a sulphur source Putative glutathione transporter, ATP-binding component 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 216.8)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 50.8)
    AAA_22; AAA domain (PF13401; HMM-score: 45.1)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 40.5)
    no clan definedoligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 36.4)
    P-loop_NTPase (CL0023) IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 30.9)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 27.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 25.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 25)
    DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 24.9)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.8)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 23.8)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 23.2)
    AAA_33; AAA domain (PF13671; HMM-score: 22.4)
    AAA_24; AAA domain (PF13479; HMM-score: 20.5)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 20.5)
    NACHT; NACHT domain (PF05729; HMM-score: 20.3)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 20.1)
    AAA_23; AAA domain (PF13476; HMM-score: 19.2)
    AAA_18; AAA domain (PF13238; HMM-score: 18.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 16.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.5)
    ABC_ATPase; Predicted ATPase of the ABC class (PF09818; HMM-score: 15.2)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.1)
    PhoH; PhoH-like protein (PF02562; HMM-score: 15)
    SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 14.5)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 14.4)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.1)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 13.3)
    ATPase; KaiC (PF06745; HMM-score: 13.1)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 12.7)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 12.6)
    Ubiquitin (CL0072) ThiS; ThiS family (PF02597; HMM-score: 12.5)
    P-loop_NTPase (CL0023) AIG1; AIG1 family (PF04548; HMM-score: 12.1)
    Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 12.1)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12)
    AAA_30; AAA domain (PF13604; HMM-score: 11.9)
    Cache (CL0165) dCache_2; Cache domain (PF08269; HMM-score: 11.8)
    P-loop_NTPase (CL0023) AAA_13; AAA domain (PF13166; HMM-score: 11.7)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 11.5)
    AAA_10; AAA-like domain (PF12846; HMM-score: 10.9)
    no clan definedDUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.8)
    P-loop_NTPase (CL0023) DUF2075; Uncharacterized conserved protein (DUF2075) (PF09848; HMM-score: 10)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 10)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.167
    • Ymax_pos: 24
    • Cmax: 0.181
    • Cmax_pos: 24
    • Smax: 0.202
    • Smax_pos: 12
    • Smean: 0.128
    • D: 0.152
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSNLLEVNSLNVQFNYDETTVQAVKNVSFELRKKHILGIVGESGSGKSITAKSILGLLPDYPDHTLTGEIIFNGQSLNNLSTSALQQIRGKDISMIFQDPLSSLNPRLTIGKQITEVIFQHKRVSKSEAKSMTIDILEKVGIKHATRQFDAYPHELSGGMRQRVMIAMALILKPQILIADEPTTALDASTQNQLLQLMKSLYEYTETSIIFITHDLGAVYQFCDDVIVMKDGSVVESGTVESIFKSPQHTYTKRLIDAIPDIHQTRPPRPLNNDILLKFDRVSVDYTSPSGSLYRAVNDINLAIRKGETLGIVGESGSGKSTLAKTVVGLKEVSEGFIWYNELPLSLFKDDELKSLRQEIQMIFQDPFASINPRFKVIDVIKRPLIIHGKVKDNDDIIKTVVSLLEKVGLDQTFLYRYPHELSGGQRQRVSIARALAVEPKVIVCDEAVSALDVSIQKDIIELLKQLQLDFGITYLFITHDMGVINEICDRVAVMKNGEIVELNNTEDIIKHPQSDYAKQLISEVAVIAK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_0143 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NWMN_1528 (CymR*)
    CymR* (TF) important in Cysteine metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]