From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0168 [new locus tag: NWMN_RS00930 ]
  • pan locus tag?: SAUPAN001093000
  • symbol: fadB
  • pan gene symbol?: fadB
  • synonym:
  • product: 3-hydroxyacyl-CoA dehydrogenase FadB-like protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0168 [new locus tag: NWMN_RS00930 ]
  • symbol: fadB
  • product: 3-hydroxyacyl-CoA dehydrogenase FadB-like protein
  • replicon: chromosome
  • strand: -
  • coordinates: 215436..217697
  • length: 2262
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    ATGACAATTAATAAAGTAACCGTTCTTGGCGCAGGCACAATGGGCGCTCAACTGGCAGCA
    CTTTTTGTGAATGCTGGACTTAAAGTAAAACTATTAGATATTGTAGTGGACAAAAACGAT
    CCAAATCTCATTGCGAAAAAATCTTACGATAAAATTACAGATAAGAAACGGCCGCTACTA
    TTCGACTTAAATCTAGCGAGTCATTTAACATATGGTAATTTTGATGATGACTTGGTAAAT
    GATGATGCTGATTTATATATCGAAGCAGTCAAAGAAGATATTGAAATTAAGCATGCTGTT
    TGGCAACAAGTTCTACAACATGCTAAAGAAGATGCTTTATTCGCTACAAATACATCAGGT
    ATTCCAATTAATGCGATTGCTCAAGCATTTAACGAGAAGGATCAAGAACGATTCTTTGGT
    CTACATTTCTTTAACCCACCACGTATTATGAAATTAGTGGAGTTAATACCTACGTCACAC
    ACGAAGGAATCTATTATATTAGATGTAAAAAATTTCGCGCAAAATGTGTTAGGTAAAGGT
    GTCATTGTCGTCAATGATGTGCCTGGCTTTGTCGCAAATAGAGTCGGCACGCAAACAATG
    AATGATATTATGTATCGCGCCGAGCAACACAAGATAAGCATTGTAGATGTGGATGCTTTA
    ACTGGGCAAGCGATTGGTCGTCCTAAAACAGGTACATATGCGCTATCTGACCTAGTCGGT
    TTAGATATTGCAGTGTCTGTAATTAAAGGCATGCAACAAGTACCTGAAGAAACACCTTAT
    TTTCATGATGTCAAAATTGTAAATACGTTGTTTGACAATGGCGCACTCGGACGTAAAACG
    AAACAAGGATTTTACAAAAAGGATAAAGAAACTAAAGCTCGACTTGTTTACGATGTTGAA
    AAACAAGATTATGTACCTGTATCGCAACCACAATTACCAATTTTAAATGAATTTAATAAA
    GACTTAGTGCATAACCTTGATACCATATTCAATGCGCAAGACGAAGCGGGACTATTTTTA
    TGGGAGACATTACGTAATAATTTCTATTACTCTGCTATCAATGTACCTAAAGCTACCGAT
    GATTTCCGAGACATAGACCGTGCGCTTGTCTGGGGGTTCAACTGGAAACTTGGTCCATTC
    CAATTATGGGATGCAATGGGATACGAACGTGTTAAAACACGTATGGAAGACGAACTTGGA
    GACTTACCACAATGGATTAGTGATTTAGATGGTGGCTTTTATAAACAAGATGAGACCATT
    GAATATGCAACACCTATTTCTCACTTCGTAAAAGATGAACTTTGGGATAAAGGTGATGCC
    AAACTTTCCGTAACTCATGATGATCAACTGTTACTGAAATTACAAAGTAAAAATAATGTC
    ATTACCGATGAATTCAACGATGCGTTAGTTGATGCGATTGATTTACTGGAAAATGACCAT
    TACACAAGTATGGTTATTTATGCAGATGGTAACAATTTCAGTGTGGGTGCTAACCTTTTC
    TTAATGAAAAAGGCGCATGAAGACGGTCTTGTAGATGATGTCGTTGCACAATCAATTGAT
    AAATTACATTATAGCTTTAATCGTTTGAAGTATAGTTTGAAACCAGTAGTCACAGCTGTT
    CAAGGTCGTGCCTTAGGCGGTGGCTGTGAGCTTGTACTTTACTCACCTATTGTTGTCGCT
    GCAAGTGAAACATATATCGGTCTTGTTGAAGCAGGTGTTGGCTTATTACCGAGTGGCGGT
    GGCCTTGCAGAAATGGCTGATCGCATATTACGCACATCGCATAAGTTTGATGACAAACAA
    GCTTCCATGACAAAAGTACTGACGAATATCGCATTTGCGAAAGTCTCTACAAATGCCTTT
    GAGGCACGTCGTTATGGTTATTTACGTGATACAGATACGATTATTTTCAATACAGCACAA
    CGTGTCGAAGTTGCGCTCAAACGTGCGAAATATGAAGCAGAAACAAACTATATTCCGAAT
    CCTAGACATCAATATATCGCTTTAGGTGAAGACTTCAAAGCATTGATCCAAGGACAATTA
    GATGCGCAAAGACGGGGTCATTTTATTAGCGACCATGATTATCATATTGCCTTAAATATC
    GCCACAATTTTAGCGGGTGGTGATTTACCAAGAAATACATTTATCAATCAACGTTACATT
    CAATCGTTGGAGAAAATTGGCTTTATTGACTTACTAAAATCTAAAAAATCATATGAAAGA
    ATTGCACATATGTTAAAAACTGGTAAGCCATTACGTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2262

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0168 [new locus tag: NWMN_RS00930 ]
  • symbol: FadB
  • description: 3-hydroxyacyl-CoA dehydrogenase FadB-like protein
  • length: 753
  • theoretical pI: 5.83805
  • theoretical MW: 84607.8
  • GRAVY: -0.242762

Function[edit source | edit]

  • reaction:
    (S)-3-hydroxyacyl-CoA + NAD+ = 3-oxoacyl-CoA + NADH?
  • TIGRFAM:
    fatty acid oxidation complex, alpha subunit, mitochondrial (TIGR02441; EC 1.1.1.35,4.2.1.17; HMM-score: 174.9)
    MetabolismFatty acid and phospholipid metabolismDegradationfatty oxidation complex, alpha subunit FadB (TIGR02437; EC 1.1.1.35,4.2.1.17,5.1.2.3,5.3.3.8; HMM-score: 168.1)
    MetabolismFatty acid and phospholipid metabolismDegradationfatty oxidation complex, alpha subunit FadJ (TIGR02440; EC 1.1.1.35,4.2.1.17,5.1.2.3; HMM-score: 154.8)
    3-hydroxyacyl-CoA dehydrogenase PaaC (TIGR02279; EC 1.1.1.-; HMM-score: 135.1)
    phenylacetate degradation probable enoyl-CoA hydratase PaaB (TIGR02280; EC 4.2.1.17; HMM-score: 41.4)
    cyclohexa-1,5-dienecarbonyl-CoA hydratase (TIGR03189; EC 4.2.1.100; HMM-score: 29)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinonenaphthoate synthase (TIGR01929; EC 4.1.3.36; HMM-score: 18)
    2-ketocyclohexanecarboxyl-CoA hydrolase (TIGR03210; EC 3.7.-.-; HMM-score: 17.4)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 14.1)
    MetabolismAmino acid biosynthesisGlutamate familypyrroline-5-carboxylate reductase (TIGR00112; EC 1.5.1.2; HMM-score: 13.7)
    MetabolismEnergy metabolismAmino acids and aminesalanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 13.4)
    benzoyl-CoA-dihydrodiol lyase (TIGR03222; EC 4.1.2.44; HMM-score: 12.9)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllgeranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 12.1)
  • TheSEED:  
    Acetyl-CoA fermentation to Butyrate Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
    Butanol Biosynthesis Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
    Butyrate metabolism cluster Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
    Isoleucine degradation Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
    Polyhydroxybutyrate metabolism Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
    Valine degradation Enoyl-CoA hydratase (EC 4.2.1.17) / Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) 
  • PFAM:
    NADP_Rossmann (CL0063) 3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 175.1)
    6PGD_C (CL0106) 3HCDH; 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain (PF00725; HMM-score: 94.2)
    ClpP_crotonase (CL0127) ECH_1; Enoyl-CoA hydratase/isomerase (PF00378; HMM-score: 60.3)
    ECH_2; Enoyl-CoA hydratase/isomerase (PF16113; HMM-score: 33.4)
    NADP_Rossmann (CL0063) NAD_binding_2; NAD binding domain of 6-phosphogluconate dehydrogenase (PF03446; HMM-score: 14.8)
    P-loop_NTPase (CL0023) CbiA; CobQ/CobB/MinD/ParA nucleotide binding domain (PF01656; HMM-score: 13.5)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 13)
    no clan definedYscW; Type III secretion system lipoprotein chaperone (YscW) (PF09619; HMM-score: 12.8)
    NADP_Rossmann (CL0063) NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 12.5)
    NAD_Gly3P_dh_N; NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus (PF01210; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_0812(ampA)cytosol aminopeptidase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.206
    • Ymax_pos: 20
    • Cmax: 0.132
    • Cmax_pos: 26
    • Smax: 0.452
    • Smax_pos: 10
    • Smean: 0.358
    • D: 0.265
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTINKVTVLGAGTMGAQLAALFVNAGLKVKLLDIVVDKNDPNLIAKKSYDKITDKKRPLLFDLNLASHLTYGNFDDDLVNDDADLYIEAVKEDIEIKHAVWQQVLQHAKEDALFATNTSGIPINAIAQAFNEKDQERFFGLHFFNPPRIMKLVELIPTSHTKESIILDVKNFAQNVLGKGVIVVNDVPGFVANRVGTQTMNDIMYRAEQHKISIVDVDALTGQAIGRPKTGTYALSDLVGLDIAVSVIKGMQQVPEETPYFHDVKIVNTLFDNGALGRKTKQGFYKKDKETKARLVYDVEKQDYVPVSQPQLPILNEFNKDLVHNLDTIFNAQDEAGLFLWETLRNNFYYSAINVPKATDDFRDIDRALVWGFNWKLGPFQLWDAMGYERVKTRMEDELGDLPQWISDLDGGFYKQDETIEYATPISHFVKDELWDKGDAKLSVTHDDQLLLKLQSKNNVITDEFNDALVDAIDLLENDHYTSMVIYADGNNFSVGANLFLMKKAHEDGLVDDVVAQSIDKLHYSFNRLKYSLKPVVTAVQGRALGGGCELVLYSPIVVAASETYIGLVEAGVGLLPSGGGLAEMADRILRTSHKFDDKQASMTKVLTNIAFAKVSTNAFEARRYGYLRDTDTIIFNTAQRVEVALKRAKYEAETNYIPNPRHQYIALGEDFKALIQGQLDAQRRGHFISDHDYHIALNIATILAGGDLPRNTFINQRYIQSLEKIGFIDLLKSKKSYERIAHMLKTGKPLRN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA
    CcpA (TF) important in Carbon catabolismRegPrecise    transcription unit transferred from N315 data RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]