From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0967 [new locus tag: NWMN_RS05420 ]
  • pan locus tag?: SAUPAN003325000
  • symbol: potC
  • pan gene symbol?: potC
  • synonym:
  • product: spermidine/putrescine ABC transporter permease protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0967 [new locus tag: NWMN_RS05420 ]
  • symbol: potC
  • product: spermidine/putrescine ABC transporter permease protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1073032..1073841
  • length: 810
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAAATGGTATGGAAAGCTGTATATCGGGATACTTTTAGCGATTTTATACATCCCAATA
    TTCTTTTTAATGTTCTATTCATTCAATTCGGCTGGTAATATGATTCACTTTGAACATTTT
    ACATTAGAGCATTATCAATCATTATTTCAAAATGATCATTTAATGTCGGTCATTTTTAAT
    ACGATAGCTGTAGCACTTTTAGCAGCCTCAATTTCTACAGTTATTGGTACATTTGGTGCC
    ATTGCTATTTATTATTTAAGAAATAAAAAGTTTAAAGTAACTTTACTAACATTGAATAAT
    GTCTTGATGGTATCATCCGACGTTGTCATAGGTGCATCATTCTTAATTATGTTTACAACG
    ATTGGCCATTTTACTGGTCTTGGTTTAGGATTTTGGACAGTTCTAATATCTCATATTGCA
    TTTTGCATACCTATAGTTGTGATTATCGTCTTACCACAACTGTATGAAATGAATAATAAT
    ATGTTAAATGCTGCAAGAGATTTAGGAGCGACTGAACCACAATTATTAAGCAACATTATT
    ATTCCTAATATTTTACCTTCTATTATAGGAGGATTCTTTATGGCTTTAACTTATTCACTA
    GACGATTTCACAGTAAGTTTCTTCGTTACTGGTAATGGCTTTAGTGTGTTATCAGTTGAA
    GTTTATGCTATGGCGAGAAAAGGAATTAGTATGGAAATTAATGCGATTTCAACATTATTG
    TTTGCTGTTATTGTATTAGGAATACTAGGATATTATTTGATTCAATACGTGATAAATAAG
    AAAAAACTAATCAAGCGAGGTGTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    810

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0967 [new locus tag: NWMN_RS05420 ]
  • symbol: PotC
  • description: spermidine/putrescine ABC transporter permease protein
  • length: 269
  • theoretical pI: 9.33859
  • theoretical MW: 30002.7
  • GRAVY: 0.904089

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, permease protein (TIGR02141; HMM-score: 53.1)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, permease protein (TIGR03262; HMM-score: 48.2)
    2-aminoethylphosphonate ABC transporter, permease protein (TIGR03226; HMM-score: 45.8)
    2-aminoethylphosphonate ABC transport system, membrane component PhnV (TIGR03255; HMM-score: 44.8)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein (TIGR00969; HMM-score: 43.6)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein CysT (TIGR02139; HMM-score: 38.8)
    NifC-like ABC-type porter (TIGR01581; HMM-score: 31.4)
    choline ABC transporter, permease protein (TIGR03416; HMM-score: 30.5)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, permease protein PstA (TIGR00974; HMM-score: 27.8)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, permease protein PstC (TIGR02138; HMM-score: 26.1)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, permease protein CysW (TIGR02140; HMM-score: 25.2)
  • TheSEED:  
    Polyamine Metabolism Spermidine/putrescine import ABC transporter permease protein PotC (TC 3.A.1.11.1) 
  • PFAM:
    BPD_transp_1 (CL0404) BPD_transp_1; Binding-protein-dependent transport system inner membrane component (PF00528; HMM-score: 64.5)
    no clan definedDUF4293; Domain of unknown function (DUF4293) (PF14126; HMM-score: 8.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 7
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.125
    • Ymax_pos: 32
    • Cmax: 0.17
    • Cmax_pos: 32
    • Smax: 0.19
    • Smax_pos: 29
    • Smean: 0.085
    • D: 0.109
  • predicted transmembrane helices (TMHMM): 6

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKWYGKLYIGILLAILYIPIFFLMFYSFNSAGNMIHFEHFTLEHYQSLFQNDHLMSVIFNTIAVALLAASISTVIGTFGAIAIYYLRNKKFKVTLLTLNNVLMVSSDVVIGASFLIMFTTIGHFTGLGLGFWTVLISHIAFCIPIVVIIVLPQLYEMNNNMLNAARDLGATEPQLLSNIIIPNILPSIIGGFFMALTYSLDDFTVSFFVTGNGFSVLSVEVYAMARKGISMEINAISTLLFAVIVLGILGYYLIQYVINKKKLIKRGVK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]