From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1042 [new locus tag: NWMN_RS05895 ]
  • pan locus tag?: SAUPAN003360000
  • symbol: isdC
  • pan gene symbol?: isdC
  • synonym:
  • product: iron-regulated cell surface protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1042 [new locus tag: NWMN_RS05895 ]
  • symbol: isdC
  • product: iron-regulated cell surface protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1145481..1146164
  • length: 684
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    TTGAAAAATATTTTAAAAGTTTTTAATACAACGATTTTAGCGTTAATTATCATCATCGCG
    ACATTCAGTAATTCTGCAAATGCCGCAGATAGCGGTACTTTGAATTATGAGGTTTACAAA
    TACAATACCAATGACACGTCAATTGCTAATGACTATTTTAATAAACCGGCAAAGTACATT
    AAGAAAAATGGTAAATTGTATGTTCAAATAACTGTCAACCACAGTCATTGGATTACTGGA
    ATGAGTATCGAAGGACATAAAGAAAATATTATTAGTAAAAACACTGCCAAAGATGAACGC
    ACTTCTGAATTTGAAGTAAGTAAGTTGAACGGTAAAATAGATGGAAAAATTGACGTTTAT
    ATCGATGAAAAAGTAAATGGAAAGCCATTCAAATATGACCATCATTACAACATTACATAT
    AAATTTAATGGACCAACTGATGTAGCAGGTGCTAATGCACCAGGTAAAGATGATAAAAAT
    TCTGCTTCAGGTAGTGACAAAGGATCTGATGGAACGACTACTGGTCAAAGTGAATCTAAT
    AGTTCGAATAAAGACAAAGTAGAAAATCCACAAACAAATGCTGGTACACCTGCATATATA
    TATGCAATACCAGTTGCATCCTTAGCATTATTAATCGCAATCACATTGTTTGTTAGAAAA
    AAATCTAAAGGCAATGTGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    684

Protein[edit source | edit]

Protein Data Bank: 2O6P

General[edit source | edit]

  • locus tag: NWMN_1042 [new locus tag: NWMN_RS05895 ]
  • symbol: IsdC
  • description: iron-regulated cell surface protein
  • length: 227
  • theoretical pI: 9.42324
  • theoretical MW: 24854.6
  • GRAVY: -0.564317

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    heme uptake protein IsdC (TIGR03656; HMM-score: 320.3)
    sortase B signal domain, NPQTN class (TIGR03068; HMM-score: 87.3)
    heme uptake protein IsdB (TIGR03657; HMM-score: 14.1)
  • TheSEED:  
    Iron acquisition and metabolismIron acquisition and metabolism - no subcategoryHeme, hemin uptake and utilization systems in GramPositives NPQTN cell wall anchored protein IsdC 
  • PFAM:
    no clan definedNEAT; Iron Transport-associated domain (PF05031; HMM-score: 88.8)
    FBD (CL0289) SoxG; Sarcosine oxidase, gamma subunit family (PF04268; HMM-score: 12.4)
    no clan definedSKG6; Transmembrane alpha-helix domain (PF08693; HMM-score: 10.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 3.33
    • Cellwall Score: 3.33
    • Extracellular Score: 3.33
    • Internal Helices: 2
  • LocateP: LPxTG Cell-wall anchored
    • Prediction by SwissProt Classification: Cell Wall
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: -2
    • Predicted Cleavage Site: found LPxTG motif :NPQTN
  • SignalP: Signal peptide length 29 aa
    • Ymax: 0.825
    • Ymax_pos: 29
    • Cmax: 0.803
    • Cmax_pos: 29
    • Smax: 0.896
    • Smax_pos: 12
    • Smean: 0.788
    • D: 0.811
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKNILKVFNTTILALIIIIATFSNSANAADSGTLNYEVYKYNTNDTSIANDYFNKPAKYIKKNGKLYVQITVNHSHWITGMSIEGHKENIISKNTAKDERTSEFEVSKLNGKIDGKIDVYIDEKVNGKPFKYDHHYNITYKFNGPTDVAGANAPGKDDKNSASGSDKGSDGTTTGQSESNSSNKDKVENPQTNAGTPAYIYAIPVASLALLIAITLFVRKKSKGNVE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: NWMN_1406 (Fur*)
    Fur* (TF) important in Iron homeostasis  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]