From AureoWiki
Jump to: navigation, search

NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1094 [new locus tag: NWMN_RS06200 ]
  • pan locus tag?: SAUPAN003454000
  • symbol: ftsQ
  • pan gene symbol?: divIB
  • synonym:
  • product: cell division protein FtsQ

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1094 [new locus tag: NWMN_RS06200 ]
  • symbol: ftsQ
  • product: cell division protein FtsQ
  • replicon: chromosome
  • strand: +
  • coordinates: 1198686..1200008
  • length: 1323
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    TTGATGGATGATAAAACGAAGAACGATCAACAAGAATCAAATGAAGATAAAGATGAATTA
    GAATTATTTACGAGGAATACATCTAAGAAAAGACGGCAAAGAAAAAGATCAAAGGCTACA
    CATTTTTCTAATCAAAATAAAGATGATACATCTCAACAAGCTGATTTTGATGAAGAAATT
    TACTTGATAAATAAAGACTTCAAAAAAGAAGAAAGCAATGATAAAAATAATGATTCTGCT
    TCTAGTCATGCGAATGATAATAATATCGATGATTCTACAGACTCTAATATTGAAAATGAG
    GATTATAGATATAATCAAGAAATTGACGACCAAAATGAATCGAATGTAATTTCAGTCGAC
    AACGAACAACCTCAATCAGCTCCTAAAGAACAAAATAGCGACTCGATTGATGAGGAAACA
    GTAACGAAAAAAGAACGAAAAAGTAAAGTAACACAATTAAAGCCATTAACACTTGAAGAA
    AAGCGGAAGTTAAGACGTAAGCGACAAAAGCGAATCCAATACAGTGTTATTACAATATTG
    GTATTGTTGATTGCTGTTATATTAATTTACATGTTTTCACCACTTAGTAAAATTGCGCAT
    GTAAATATAAATGGAAATAATCACGTTAGTACTTCAAAGATAAACAAAGTTTTAGGTGTT
    AAAAATGATTCAAGGATGTATACGTTTAGTAAAAAAAATGCTATTAATGATCTCGAAGAG
    AATCCATTAATCAAAAGTGTTGAGATACACAAGCAATTACCAAACACATTAAACGTAGAT
    ATCACAGAAAATGAAATTATTGCTTTAGTGAAATATAAAGGTAAATATTTACCTTTATTA
    GAAAATGGTAAATTGCTTAAAGGTTCAAATGATGTCAAAATTAATGATGCACCTGTCATG
    GATGGTTTCAAAGGTACAAAAGAAGATGATATGATTAAGGCGTTATCTGAAATGACACCT
    GAAGTTAGACGATATATTGCCGAAGTGACATACGCCCCAAGTAAAAACAAACAAAGCAGA
    ATTGAATTGTTTACGACAGATGGACTTCAAGTAATCGGTGATATTTCGACGATATCTAAG
    AAAATGAAATATTATCCGCAGATGTCACAATCATTATCAAGGGATAGTTCGGGTAAACTA
    AAAACACGAGGCTATATTGATTTATCAGTCGGTGCTTCATTTATCCCATACCGTGGAAAC
    ACGTCTAGTCAATCAGAAAGCGATAAAAATGTGACTAAATCATCTCAAGAGGAAAATCAA
    GCAAAAGAAGAATTACAAAGCGTTTTAAACAAAATTAACAAACAATCAAGTAAGAATAAT
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1323

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1094 [new locus tag: NWMN_RS06200 ]
  • symbol: FtsQ
  • description: cell division protein FtsQ
  • length: 440
  • theoretical pI: 8.50233
  • theoretical MW: 50342.8
  • GRAVY: -1.03136

Function[edit source | edit]

  • TIGRFAM:
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter permease LptF (TIGR04407; HMM-score: 12.9)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter permease LptF (TIGR04407; HMM-score: 12.9)
  • TheSEED:  
    Cell Division and Cell CycleCell Division and Cell Cycle - no subcategoryBacterial Cytoskeleton Cell division protein FtsQ
    and 4 more
    Clustering-based subsystemsCell DivisionCell Division Cluster Cell division protein FtsQ
    cell division cluster containing FtsQ Cell division protein FtsQ
    Bacterial Cell Division Cell division protein FtsQ
    RP Bacterial Cell Division Cell division protein FtsQ
  • PFAM:
    POTRA (CL0191) POTRA_1; POTRA domain, FtsQ-type (PF08478; HMM-score: 66.9)
    and 5 more
    POTRA; Surface antigen variable number repeat (PF07244; HMM-score: 17.5)
    no clan definedSigma_reg_N; Sigma factor regulator N-terminal (PF13800; HMM-score: 13.2)
    BPD_transp_1 (CL0404) YjgP_YjgQ; Predicted permease YjgP/YjgQ family (PF03739; HMM-score: 11.7)
    no clan definedDUF5316; Family of unknown function (DUF5316) (PF17247; HMM-score: 11.2)
    T2SSF; Type II secretion system (T2SS), protein F (PF00482; HMM-score: 10.9)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.53
    • Cellwall Score: 8.75
    • Extracellular Score: 0.7
    • Internal Helix: 1
  • LocateP: Intracellular /TMH start AFTER 60
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: Possibly Sec-
    • Intracellular Possibility: 0.17
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.159
    • Ymax_pos: 40
    • Cmax: 0.123
    • Cmax_pos: 40
    • Smax: 0.272
    • Smax_pos: 36
    • Smean: 0.151
    • D: 0.156
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MMDDKTKNDQQESNEDKDELELFTRNTSKKRRQRKRSKATHFSNQNKDDTSQQADFDEEIYLINKDFKKEESNDKNNDSASSHANDNNIDDSTDSNIENEDYRYNQEIDDQNESNVISVDNEQPQSAPKEQNSDSIDEETVTKKERKSKVTQLKPLTLEEKRKLRRKRQKRIQYSVITILVLLIAVILIYMFSPLSKIAHVNINGNNHVSTSKINKVLGVKNDSRMYTFSKKNAINDLEENPLIKSVEIHKQLPNTLNVDITENEIIALVKYKGKYLPLLENGKLLKGSNDVKINDAPVMDGFKGTKEDDMIKALSEMTPEVRRYIAEVTYAPSKNKQSRIELFTTDGLQVIGDISTISKKMKYYPQMSQSLSRDSSGKLKTRGYIDLSVGASFIPYRGNTSSQSESDKNVTKSSQEENQAKEELQSVLNKINKQSSKNN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]